Incidental Mutation 'R5988:Fat1'
ID481827
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene NameFAT atypical cadherin 1
SynonymsmFat1, Fath, 2310038E12Rik
MMRRC Submission 044168-MU
Accession Numbers

Genbank: NM_001081286

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location44935447-45052257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45029456 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3051 (T3051A)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
Predicted Effect probably benign
Transcript: ENSMUST00000098796
AA Change: T3028A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: T3028A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189017
AA Change: T3028A
Predicted Effect probably benign
Transcript: ENSMUST00000191428
AA Change: T3028A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: T3028A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215588
AA Change: T3051A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45024602 missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44951670 missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45050940 missense probably benign 0.18
IGL00983:Fat1 APN 8 45033390 missense probably damaging 1.00
IGL01089:Fat1 APN 8 45017857 missense probably damaging 1.00
IGL01135:Fat1 APN 8 45024840 missense probably damaging 1.00
IGL01143:Fat1 APN 8 45035532 missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45023949 missense probably damaging 1.00
IGL01376:Fat1 APN 8 45026841 missense probably benign 0.00
IGL01411:Fat1 APN 8 45026800 missense probably damaging 1.00
IGL01443:Fat1 APN 8 45040576 missense probably damaging 1.00
IGL01453:Fat1 APN 8 45051270 missense probably damaging 1.00
IGL01606:Fat1 APN 8 45023049 missense probably benign 0.26
IGL01622:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45040700 missense probably benign 0.05
IGL01735:Fat1 APN 8 45036239 missense probably benign 0.07
IGL01793:Fat1 APN 8 44989112 missense probably benign
IGL01820:Fat1 APN 8 45010502 missense probably damaging 1.00
IGL01969:Fat1 APN 8 44952599 missense probably damaging 0.98
IGL02012:Fat1 APN 8 45027540 missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45023659 missense probably damaging 1.00
IGL02256:Fat1 APN 8 44950332 missense probably damaging 1.00
IGL02273:Fat1 APN 8 44950331 missense probably damaging 1.00
IGL02317:Fat1 APN 8 45025818 missense probably benign 0.33
IGL02324:Fat1 APN 8 45040556 missense probably damaging 1.00
IGL02336:Fat1 APN 8 44951583 missense probably benign 0.16
IGL02442:Fat1 APN 8 44950323 missense probably benign 0.02
IGL02486:Fat1 APN 8 45025072 missense probably benign 0.16
IGL02551:Fat1 APN 8 45051398 missense probably damaging 1.00
IGL02617:Fat1 APN 8 45035591 missense probably benign 0.31
IGL02698:Fat1 APN 8 45023164 missense probably benign
IGL02885:Fat1 APN 8 44989167 missense probably benign 0.01
IGL02904:Fat1 APN 8 45040682 missense probably damaging 1.00
IGL02953:Fat1 APN 8 45024314 missense probably damaging 1.00
IGL03108:Fat1 APN 8 45023614 missense probably damaging 1.00
IGL03153:Fat1 APN 8 45030123 missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44950586 missense probably damaging 0.99
IGL03327:Fat1 APN 8 44950468 missense probably damaging 1.00
IGL03405:Fat1 APN 8 45025241 missense probably damaging 1.00
Laggardly UTSW 8 45044464 missense probably damaging 1.00
Shrinkage UTSW 8 45018037 missense probably damaging 1.00
F5493:Fat1 UTSW 8 45025480 missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45026404 missense probably damaging 1.00
I2289:Fat1 UTSW 8 45024996 missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45017434 missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45029540 missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45037207 missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45024645 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0078:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R0197:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0328:Fat1 UTSW 8 45023790 missense probably benign 0.35
R0367:Fat1 UTSW 8 45024313 missense probably damaging 1.00
R0371:Fat1 UTSW 8 44951892 missense probably damaging 1.00
R0380:Fat1 UTSW 8 45010123 missense probably damaging 0.97
R0389:Fat1 UTSW 8 44950348 missense probably benign 0.00
R0433:Fat1 UTSW 8 45024649 missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45029534 missense probably damaging 1.00
R0494:Fat1 UTSW 8 44950542 missense probably damaging 1.00
R0506:Fat1 UTSW 8 45022951 missense probably damaging 0.99
R0512:Fat1 UTSW 8 44951332 nonsense probably null
R0624:Fat1 UTSW 8 45051168 missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0723:Fat1 UTSW 8 45026749 missense probably damaging 1.00
R0787:Fat1 UTSW 8 45040555 missense probably damaging 1.00
R0788:Fat1 UTSW 8 45023983 missense probably benign 0.27
R0862:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0864:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0907:Fat1 UTSW 8 45026598 missense probably benign 0.08
R0962:Fat1 UTSW 8 45033326 splice site probably benign
R1051:Fat1 UTSW 8 45044506 missense probably damaging 1.00
R1156:Fat1 UTSW 8 45039890 missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45044279 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1478:Fat1 UTSW 8 45025622 missense probably damaging 0.99
R1482:Fat1 UTSW 8 44953244 missense probably benign 0.04
R1496:Fat1 UTSW 8 45033390 missense probably damaging 1.00
R1498:Fat1 UTSW 8 45025484 nonsense probably null
R1508:Fat1 UTSW 8 45026862 missense probably benign 0.01
R1577:Fat1 UTSW 8 45023383 missense probably benign 0.30
R1646:Fat1 UTSW 8 45018042 missense probably damaging 1.00
R1652:Fat1 UTSW 8 45025178 nonsense probably null
R1656:Fat1 UTSW 8 45025530 nonsense probably null
R1662:Fat1 UTSW 8 44953164 missense probably benign 0.20
R1672:Fat1 UTSW 8 45036835 missense probably damaging 1.00
R1704:Fat1 UTSW 8 45025576 missense probably damaging 1.00
R1708:Fat1 UTSW 8 45024792 missense probably damaging 1.00
R1710:Fat1 UTSW 8 45010482 missense probably benign 0.00
R1812:Fat1 UTSW 8 45036803 missense probably damaging 1.00
R1872:Fat1 UTSW 8 44953304 missense probably benign 0.01
R1872:Fat1 UTSW 8 45038349 missense probably damaging 1.00
R1883:Fat1 UTSW 8 45051147 missense probably benign 0.17
R1893:Fat1 UTSW 8 45023856 missense probably damaging 1.00
R1930:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45033926 missense probably benign 0.00
R1957:Fat1 UTSW 8 45040682 missense probably damaging 1.00
R1999:Fat1 UTSW 8 44952393 missense probably damaging 0.96
R2019:Fat1 UTSW 8 45023746 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45024332 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45026704 missense probably damaging 1.00
R2117:Fat1 UTSW 8 45037463 missense probably benign 0.33
R2196:Fat1 UTSW 8 45024646 missense probably damaging 1.00
R2204:Fat1 UTSW 8 45023700 missense probably damaging 1.00
R2256:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2257:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2409:Fat1 UTSW 8 45040530 splice site probably benign
R2416:Fat1 UTSW 8 45026383 missense probably damaging 1.00
R3021:Fat1 UTSW 8 45044011 missense probably damaging 1.00
R3108:Fat1 UTSW 8 45045173 splice site probably null
R3109:Fat1 UTSW 8 45045173 splice site probably null
R3196:Fat1 UTSW 8 44951868 missense probably benign 0.00
R3683:Fat1 UTSW 8 45017938 missense probably benign
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45025479 missense probably damaging 0.97
R3905:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3907:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3908:Fat1 UTSW 8 45023035 missense probably benign 0.00
R4060:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4061:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4062:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4063:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4078:Fat1 UTSW 8 44989122 missense probably damaging 0.99
R4105:Fat1 UTSW 8 45036851 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45010437 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45050944 missense probably damaging 1.00
R4161:Fat1 UTSW 8 45036787 missense probably benign 0.00
R4364:Fat1 UTSW 8 44952962 missense probably benign 0.01
R4394:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4395:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4396:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4412:Fat1 UTSW 8 45023599 missense probably damaging 0.99
R4542:Fat1 UTSW 8 45041894 missense probably damaging 1.00
R4591:Fat1 UTSW 8 45026242 missense probably benign
R4606:Fat1 UTSW 8 44950683 missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45025147 missense probably damaging 1.00
R4730:Fat1 UTSW 8 45033477 missense probably damaging 1.00
R4778:Fat1 UTSW 8 45038326 missense probably benign 0.04
R4824:Fat1 UTSW 8 44989114 missense probably damaging 1.00
R4829:Fat1 UTSW 8 45036162 missense probably damaging 1.00
R4832:Fat1 UTSW 8 45013065 missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45012970 missense probably benign 0.15
R4896:Fat1 UTSW 8 44951280 missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45022963 missense probably damaging 0.96
R4941:Fat1 UTSW 8 45036275 missense probably benign 0.00
R5011:Fat1 UTSW 8 45031263 critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45023380 missense probably damaging 1.00
R5112:Fat1 UTSW 8 45024282 missense probably damaging 1.00
R5151:Fat1 UTSW 8 44951814 missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44952512 missense probably benign 0.00
R5162:Fat1 UTSW 8 45025809 missense probably benign 0.02
R5353:Fat1 UTSW 8 45036131 missense probably benign 0.13
R5425:Fat1 UTSW 8 45025885 missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45013053 missense probably damaging 1.00
R5479:Fat1 UTSW 8 45036875 missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45023479 missense probably damaging 0.99
R5569:Fat1 UTSW 8 45039836 missense probably damaging 0.98
R5610:Fat1 UTSW 8 44953072 nonsense probably null
R5734:Fat1 UTSW 8 45051209 missense probably damaging 0.99
R5832:Fat1 UTSW 8 45017423 missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45051129 missense probably benign
R5886:Fat1 UTSW 8 45027681 critical splice donor site probably null
R5886:Fat1 UTSW 8 45033395 missense probably damaging 1.00
R5919:Fat1 UTSW 8 45026873 critical splice donor site probably null
R5930:Fat1 UTSW 8 45044036 missense probably benign 0.10
R5960:Fat1 UTSW 8 45033368 missense probably damaging 1.00
R6166:Fat1 UTSW 8 44952485 missense probably damaging 1.00
R6184:Fat1 UTSW 8 44953392 missense probably benign 0.00
R6208:Fat1 UTSW 8 45027613 missense probably damaging 0.99
R6351:Fat1 UTSW 8 45033495 missense probably damaging 1.00
R6391:Fat1 UTSW 8 44952342 missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44950681 missense probably damaging 1.00
R6702:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6703:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6704:Fat1 UTSW 8 45024373 missense probably damaging 1.00
R6822:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R6852:Fat1 UTSW 8 45035598 missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45044464 missense probably damaging 1.00
R6885:Fat1 UTSW 8 44952452 missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45051023 missense probably benign 0.00
R6927:Fat1 UTSW 8 45024495 missense probably benign 0.41
R6964:Fat1 UTSW 8 45043945 missense probably damaging 1.00
R7010:Fat1 UTSW 8 44953349 nonsense probably null
R7062:Fat1 UTSW 8 44950216 start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45040775 missense probably benign 0.09
R7071:Fat1 UTSW 8 44989108 missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45031468 missense probably damaging 0.98
R7146:Fat1 UTSW 8 44950925 missense probably benign
R7210:Fat1 UTSW 8 45023503 missense probably damaging 1.00
R7227:Fat1 UTSW 8 45010609 missense probably benign 0.08
R7270:Fat1 UTSW 8 45037438 missense probably damaging 1.00
R7373:Fat1 UTSW 8 45026665 missense probably damaging 1.00
R7390:Fat1 UTSW 8 44952474 missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45044152 missense probably benign 0.35
R7476:Fat1 UTSW 8 45031274 missense probably benign 0.01
R7483:Fat1 UTSW 8 45023160 missense probably benign 0.13
R7484:Fat1 UTSW 8 45036184 missense probably damaging 1.00
R7526:Fat1 UTSW 8 45023427 missense probably damaging 1.00
R7549:Fat1 UTSW 8 44988994 missense probably benign 0.01
R7554:Fat1 UTSW 8 45037165 missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45009850 missense possibly damaging 0.95
R7652:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R7694:Fat1 UTSW 8 44988930 critical splice acceptor site probably null
R7746:Fat1 UTSW 8 44951633 missense probably damaging 0.96
R7762:Fat1 UTSW 8 45023322 missense probably damaging 1.00
R7762:Fat1 UTSW 8 45037337 missense probably damaging 0.99
R7782:Fat1 UTSW 8 44950911 missense probably damaging 1.00
R7801:Fat1 UTSW 8 45042223 missense probably damaging 1.00
R7807:Fat1 UTSW 8 45041973 missense probably damaging 1.00
R7821:Fat1 UTSW 8 44950224 missense probably benign
R7869:Fat1 UTSW 8 45051222 missense probably benign 0.02
R8034:Fat1 UTSW 8 44951691 missense probably benign 0.28
R8094:Fat1 UTSW 8 44952702 missense probably damaging 0.98
R8111:Fat1 UTSW 8 45026058 missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45039956 missense probably null
R8221:Fat1 UTSW 8 44953353 missense
R8233:Fat1 UTSW 8 44952018 missense
R8250:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R8279:Fat1 UTSW 8 45030347 critical splice donor site probably null
R8726:Fat1 UTSW 8 45024169 missense probably benign 0.23
RF001:Fat1 UTSW 8 44988966 missense probably benign 0.00
X0064:Fat1 UTSW 8 45025734 missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45023807 missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 44950598 missense probably benign
Z1176:Fat1 UTSW 8 45023596 missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 45036838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTACCTGTTACAAGGCTC -3'
(R):5'- TCATGTCTCCCACACAGAGG -3'

Sequencing Primer
(F):5'- CCTTGTTCCCACATCTGTTTTATAAG -3'
(R):5'- ATTAAGTTAGTCCCAAATTCCATCC -3'
Posted On2017-06-26