Incidental Mutation 'R5988:Olfr59'
ID481847
Institutional Source Beutler Lab
Gene Symbol Olfr59
Ensembl Gene ENSMUSG00000070374
Gene Nameolfactory receptor 59
SynonymsMOR133-3P, IH3, GA_x6K02T2P1NL-4434429-4435400
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74283736-74291608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74288853 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000148959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143976] [ENSMUST00000205790] [ENSMUST00000206659] [ENSMUST00000214048]
Predicted Effect probably benign
Transcript: ENSMUST00000119717
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112522
Gene: ENSMUSG00000070374
AA Change: V69A

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 2.2e-59 PFAM
Pfam:7tm_1 41 292 3.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143976
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119877
Gene: ENSMUSG00000070374
AA Change: V69A

DomainStartEndE-ValueType
Pfam:7tm_1 41 237 7.5e-34 PFAM
Pfam:7tm_4 139 237 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205790
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206659
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214048
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Olfr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr59 APN 11 74289126 missense probably damaging 1.00
IGL00337:Olfr59 APN 11 74289387 missense probably damaging 0.97
IGL01307:Olfr59 APN 11 74289428 missense possibly damaging 0.88
IGL01488:Olfr59 APN 11 74288688 missense probably damaging 1.00
IGL02583:Olfr59 APN 11 74289504 missense probably damaging 1.00
IGL02839:Olfr59 APN 11 74289370 nonsense probably null
IGL02996:Olfr59 APN 11 74289165 missense probably benign 0.08
R0013:Olfr59 UTSW 11 74289051 missense possibly damaging 0.88
R0077:Olfr59 UTSW 11 74288675 missense probably benign 0.00
R0078:Olfr59 UTSW 11 74289266 missense probably damaging 1.00
R0734:Olfr59 UTSW 11 74288946 missense probably damaging 1.00
R1033:Olfr59 UTSW 11 74288666 missense probably damaging 0.99
R1556:Olfr59 UTSW 11 74288936 missense probably damaging 1.00
R1721:Olfr59 UTSW 11 74289300 missense probably damaging 1.00
R1737:Olfr59 UTSW 11 74288811 missense probably damaging 1.00
R1848:Olfr59 UTSW 11 74289213 missense probably damaging 0.99
R1881:Olfr59 UTSW 11 74288666 missense probably benign 0.08
R2057:Olfr59 UTSW 11 74288826 missense probably damaging 1.00
R2107:Olfr59 UTSW 11 74289390 missense probably damaging 1.00
R4399:Olfr59 UTSW 11 74288856 missense probably damaging 1.00
R4633:Olfr59 UTSW 11 74289294 missense probably benign 0.00
R5593:Olfr59 UTSW 11 74288792 missense possibly damaging 0.65
R6104:Olfr59 UTSW 11 74289366 missense probably damaging 1.00
R7436:Olfr59 UTSW 11 74288685 missense possibly damaging 0.84
R7506:Olfr59 UTSW 11 74289123 missense possibly damaging 0.96
R7769:Olfr59 UTSW 11 74288763 missense probably damaging 1.00
Z1088:Olfr59 UTSW 11 74288835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCACCTTTGAGTTCC -3'
(R):5'- CGCTGGAAGCTCATGATCATC -3'

Sequencing Primer
(F):5'- TGAGTTCCTCCTCTGGGGAC -3'
(R):5'- GCTCATGATCATCCTATAGTGGAGAG -3'
Posted On2017-06-26