Incidental Mutation 'R5988:Myh6'
ID481862
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54965394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 23 (R23S)
Ref Sequence ENSEMBL: ENSMUSP00000107083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000111456] [ENSMUST00000124930] [ENSMUST00000134256] [ENSMUST00000226297]
Predicted Effect probably benign
Transcript: ENSMUST00000081857
AA Change: R23S

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: R23S

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111456
AA Change: R23S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107083
Gene: ENSMUSG00000040752
AA Change: R23S

DomainStartEndE-ValueType
Pfam:Myosin_N 34 63 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124930
AA Change: R23S

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115615
Gene: ENSMUSG00000040752
AA Change: R23S

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 1.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134256
AA Change: R23S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116370
Gene: ENSMUSG00000040752
AA Change: R23S

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181782
SMART Domains Protein: ENSMUSP00000137786
Gene: ENSMUSG00000097652

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 44 94 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185798
Predicted Effect probably benign
Transcript: ENSMUST00000226297
AA Change: R23S

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAACATATCTTGGCATCCC -3'
(R):5'- ACATAGAGTCCTGGTGGGAG -3'

Sequencing Primer
(F):5'- TACAGGAGGCTCTGCTCCAAC -3'
(R):5'- TCCTGGTGGGAGAGCCATAG -3'
Posted On2017-06-26