Incidental Mutation 'R0515:Mill1'
ID48187
Institutional Source Beutler Lab
Gene Symbol Mill1
Ensembl Gene ENSMUSG00000054005
Gene NameMHC I like leukocyte 1
Synonyms5530400I18Rik
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18245347-18266092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18264873 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000069083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066780]
Predicted Effect probably benign
Transcript: ENSMUST00000066780
AA Change: V336A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069083
Gene: ENSMUSG00000054005
AA Change: V336A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MHC_I 60 236 3.8e-33 PFAM
IGc1 255 327 3.53e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Mill1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Mill1 APN 7 18264641 missense possibly damaging 0.91
IGL01313:Mill1 APN 7 18264633 missense possibly damaging 0.82
IGL01417:Mill1 APN 7 18264783 missense probably benign 0.18
IGL01997:Mill1 APN 7 18255889 missense probably damaging 1.00
IGL02282:Mill1 APN 7 18263204 critical splice donor site probably null
IGL03126:Mill1 APN 7 18255907 missense probably benign 0.33
IGL03197:Mill1 APN 7 18264665 missense probably benign 0.02
R0513:Mill1 UTSW 7 18264877 nonsense probably null
R1460:Mill1 UTSW 7 18262670 missense probably damaging 1.00
R1589:Mill1 UTSW 7 18245647 missense probably benign 0.01
R2192:Mill1 UTSW 7 18264619 nonsense probably null
R3704:Mill1 UTSW 7 18263053 missense possibly damaging 0.91
R3758:Mill1 UTSW 7 18262703 critical splice donor site probably null
R4685:Mill1 UTSW 7 18255928 missense probably damaging 0.98
R4753:Mill1 UTSW 7 18262547 missense probably benign 0.28
R5763:Mill1 UTSW 7 18245662 missense probably benign 0.03
R5938:Mill1 UTSW 7 18262688 missense probably benign 0.00
R7757:Mill1 UTSW 7 18262466 missense probably benign 0.02
Z1176:Mill1 UTSW 7 18245499 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGACATGCCGGGCTTTTC -3'
(R):5'- AGTAGCATTGCACTTCCACCAGG -3'

Sequencing Primer
(F):5'- CCTGACCTGGCTTCAGTATAGAAAG -3'
(R):5'- CATTCACCAGTGTGGTAAAATGG -3'
Posted On2013-06-12