Incidental Mutation 'R5988:Ahnak'
ID481879
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 9009347 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000092956
AA Change: P2665Q
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: P2665Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
Nanook UTSW 19 9003231 missense probably benign 0.42
Netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 9006176 missense possibly damaging 0.87
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense possibly damaging 0.61
R7181:Ahnak UTSW 19 9013488 missense probably damaging 1.00
R7183:Ahnak UTSW 19 9017668 missense probably damaging 1.00
R7202:Ahnak UTSW 19 9017799 missense probably damaging 1.00
R7235:Ahnak UTSW 19 9012488 missense unknown
R7241:Ahnak UTSW 19 9009031 missense possibly damaging 0.65
R7269:Ahnak UTSW 19 9006617 missense probably damaging 1.00
R7311:Ahnak UTSW 19 9002143 missense probably benign 0.04
R7311:Ahnak UTSW 19 9009827 missense possibly damaging 0.56
R7329:Ahnak UTSW 19 9001792 missense probably damaging 0.99
R7339:Ahnak UTSW 19 9008165 missense possibly damaging 0.75
R7390:Ahnak UTSW 19 9003205 missense probably benign 0.02
R7400:Ahnak UTSW 19 9014613 missense probably damaging 0.99
R7444:Ahnak UTSW 19 9007423 missense probably benign 0.08
R7483:Ahnak UTSW 19 9004822 missense probably damaging 1.00
R7498:Ahnak UTSW 19 9012019 missense probably benign 0.14
R7521:Ahnak UTSW 19 9002351 missense possibly damaging 0.89
R7522:Ahnak UTSW 19 9002322 missense probably benign 0.01
R7552:Ahnak UTSW 19 9006824 missense probably benign 0.18
R7563:Ahnak UTSW 19 9011165 missense probably damaging 0.99
R7565:Ahnak UTSW 19 9016156 missense probably benign 0.05
R7571:Ahnak UTSW 19 9000786 nonsense probably null
R7583:Ahnak UTSW 19 9006093 missense possibly damaging 0.90
R7600:Ahnak UTSW 19 9004574 missense possibly damaging 0.89
R7771:Ahnak UTSW 19 9015047 missense probably damaging 0.99
R7787:Ahnak UTSW 19 9009315 missense unknown
R7827:Ahnak UTSW 19 9005344 nonsense probably null
R7857:Ahnak UTSW 19 9007468 missense probably damaging 0.97
R7940:Ahnak UTSW 19 9007468 missense probably damaging 0.97
RF007:Ahnak UTSW 19 9013601 missense possibly damaging 0.45
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTCTGCCCAAAGTGGAAG -3'
(R):5'- TGAGGTCACCTTCCACTTTG -3'

Sequencing Primer
(F):5'- GCCCCAAAGTGGACATTGATGTTC -3'
(R):5'- CTTTGGGCAGGGAAACATCTACATC -3'
Posted On2017-06-26