Incidental Mutation 'R0515:Siglecf'
ID48188
Institutional Source Beutler Lab
Gene Symbol Siglecf
Ensembl Gene ENSMUSG00000039013
Gene Namesialic acid binding Ig-like lectin F
SynonymsmSiglec-F, Siglec5
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43351341-43359531 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 43355631 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000122423] [ENSMUST00000206299] [ENSMUST00000206299]
Predicted Effect probably null
Transcript: ENSMUST00000012798
SMART Domains Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121494
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121494
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122423
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122423
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145867
Predicted Effect probably null
Transcript: ENSMUST00000206299
Predicted Effect probably null
Transcript: ENSMUST00000206299
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Siglecf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Siglecf APN 7 43351953 nonsense probably null
IGL01350:Siglecf APN 7 43355895 intron probably benign
IGL01458:Siglecf APN 7 43355138 missense possibly damaging 0.46
IGL01582:Siglecf APN 7 43358721 missense possibly damaging 0.55
IGL02347:Siglecf APN 7 43351721 missense possibly damaging 0.78
IGL02530:Siglecf APN 7 43352210 missense probably benign 0.07
IGL02700:Siglecf APN 7 43352378 missense probably damaging 1.00
IGL03093:Siglecf APN 7 43352441 missense probably damaging 1.00
IGL03178:Siglecf APN 7 43358739 missense probably damaging 0.98
IGL03280:Siglecf APN 7 43355930 missense probably benign 0.04
ANU23:Siglecf UTSW 7 43351953 nonsense probably null
R0003:Siglecf UTSW 7 43355926 missense probably benign
R0025:Siglecf UTSW 7 43351925 missense probably benign 0.29
R0304:Siglecf UTSW 7 43352401 missense probably damaging 1.00
R0345:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R0395:Siglecf UTSW 7 43355975 missense probably damaging 1.00
R1296:Siglecf UTSW 7 43355920 nonsense probably null
R1861:Siglecf UTSW 7 43352224 missense probably benign 0.00
R1861:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1869:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1870:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1871:Siglecf UTSW 7 43355543 missense probably benign 0.01
R2063:Siglecf UTSW 7 43352380 missense possibly damaging 0.79
R2176:Siglecf UTSW 7 43351716 missense probably damaging 0.98
R2237:Siglecf UTSW 7 43354985 missense probably benign 0.06
R4023:Siglecf UTSW 7 43355571 missense possibly damaging 0.56
R4498:Siglecf UTSW 7 43352276 missense possibly damaging 0.47
R4664:Siglecf UTSW 7 43356413 missense possibly damaging 0.75
R5227:Siglecf UTSW 7 43351940 missense probably damaging 1.00
R5315:Siglecf UTSW 7 43355108 missense probably benign 0.01
R5763:Siglecf UTSW 7 43356320 nonsense probably null
R5828:Siglecf UTSW 7 43351713 missense probably damaging 1.00
R5871:Siglecf UTSW 7 43355621 missense probably benign 0.04
R5952:Siglecf UTSW 7 43355927 missense probably benign 0.00
R6054:Siglecf UTSW 7 43355006 missense probably damaging 1.00
R6537:Siglecf UTSW 7 43355999 missense probably benign
R6854:Siglecf UTSW 7 43352180 missense probably benign 0.00
R6875:Siglecf UTSW 7 43355200 missense probably benign 0.04
R7328:Siglecf UTSW 7 43352267 missense possibly damaging 0.92
R7329:Siglecf UTSW 7 43351971 missense probably damaging 1.00
R7356:Siglecf UTSW 7 43356431 missense probably benign 0.00
R7369:Siglecf UTSW 7 43351817 missense probably damaging 0.99
R7659:Siglecf UTSW 7 43351770 missense probably damaging 1.00
R8074:Siglecf UTSW 7 43351790 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAGCAGCAATGGCTCCTTCAC -3'
(R):5'- AGCAGGCATCTTAGCGTCCAAC -3'

Sequencing Primer
(F):5'- AATGGCTCCTTCACGGTTAAG -3'
(R):5'- GTGAGAATGTCCCCTCCCAC -3'
Posted On2013-06-12