Incidental Mutation 'R5989:Gm42417'
ID481884
Institutional Source Beutler Lab
Gene Symbol Gm42417
Ensembl Gene ENSMUSG00000109510
Gene Namepredicted gene, 42417
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36530193-36539429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36532192 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 183 (F183L)
Ref Sequence ENSEMBL: ENSMUSP00000061168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001166] [ENSMUST00000054665] [ENSMUST00000097776] [ENSMUST00000191849] [ENSMUST00000193083] [ENSMUST00000194853] [ENSMUST00000207088]
Predicted Effect probably benign
Transcript: ENSMUST00000001166
SMART Domains Protein: ENSMUSP00000001166
Gene: ENSMUSG00000001138

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 25 35 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF21 142 295 3.2e-10 PFAM
Blast:CBS 329 379 9e-12 BLAST
Pfam:CBS 388 452 6.4e-6 PFAM
Blast:cNMP 527 668 2e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000054665
AA Change: F183L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061168
Gene: ENSMUSG00000067653
AA Change: F183L

DomainStartEndE-ValueType
coiled coil region 45 74 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
Blast:ANK 111 140 1e-9 BLAST
ANK 144 173 1.12e-3 SMART
ANK 177 206 1.4e-4 SMART
ANK 210 239 9.27e-5 SMART
ANK 243 272 7.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097776
SMART Domains Protein: ENSMUSP00000095383
Gene: ENSMUSG00000001138

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 25 35 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF21 142 300 1e-19 PFAM
Blast:CBS 329 379 9e-12 BLAST
Pfam:CBS 388 452 5.1e-6 PFAM
Blast:cNMP 527 668 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191849
AA Change: F69L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142202
Gene: ENSMUSG00000109510
AA Change: F69L

DomainStartEndE-ValueType
Blast:ANK 1 26 9e-9 BLAST
ANK 30 59 1.12e-3 SMART
ANK 63 92 1.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192037
Predicted Effect probably damaging
Transcript: ENSMUST00000193083
AA Change: F69L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141394
Gene: ENSMUSG00000067653
AA Change: F69L

DomainStartEndE-ValueType
Blast:ANK 1 26 1e-8 BLAST
ANK 30 59 6.9e-6 SMART
ANK 63 92 8.9e-7 SMART
ANK 96 125 5.7e-7 SMART
ANK 129 158 4.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193991
Predicted Effect probably damaging
Transcript: ENSMUST00000194853
AA Change: F183L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141541
Gene: ENSMUSG00000067653
AA Change: F183L

DomainStartEndE-ValueType
coiled coil region 45 74 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
Blast:ANK 111 140 2e-9 BLAST
ANK 144 173 1.12e-3 SMART
ANK 177 206 1.4e-4 SMART
ANK 210 239 7.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207088
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Gm42417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0497:Gm42417 UTSW 1 36532167 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGATAAGGTGCTCTAGGC -3'
(R):5'- CAGACAGCTGGTGAACAAGC -3'

Sequencing Primer
(F):5'- AGGGGTGCTCCAGATCTAG -3'
(R):5'- GCTGGTGAACAAGCTGCTG -3'
Posted On2017-06-26