Incidental Mutation 'R5989:Prkag3'
ID481885
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74741274 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 411 (N411D)
Ref Sequence ENSEMBL: ENSMUSP00000139909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect probably benign
Transcript: ENSMUST00000027356
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081636
AA Change: N411D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542
AA Change: N411D

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113672
AA Change: N386D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542
AA Change: N386D

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160732
AA Change: N411D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542
AA Change: N411D

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162093
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188073
AA Change: N411D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542
AA Change: N411D

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190781
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R0547:Prkag3 UTSW 1 74744720 critical splice donor site probably null
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R2842:Prkag3 UTSW 1 74741175 missense probably benign 0.30
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5159:Prkag3 UTSW 1 74741487 missense probably damaging 1.00
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R7444:Prkag3 UTSW 1 74747266 missense probably benign 0.00
R7553:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R7630:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R8084:Prkag3 UTSW 1 74747207 missense probably damaging 1.00
R8115:Prkag3 UTSW 1 74747959 missense possibly damaging 0.49
Z1177:Prkag3 UTSW 1 74748025 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCAGCTGGCTGTGGATC -3'
(R):5'- ACACTTACAGGGAGGTGCTG -3'

Sequencing Primer
(F):5'- CCTACCAATGTAGATGCCAAAAGTTG -3'
(R):5'- TGCAGGGAGGTTGCAGAATG -3'
Posted On2017-06-26