Incidental Mutation 'R0515:Klk1b5'
ID48189
Institutional Source Beutler Lab
Gene Symbol Klk1b5
Ensembl Gene ENSMUSG00000066512
Gene Namekallikrein 1-related peptidase b5
SynonymsmGK-5, Klk5
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44215945-44220703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44218533 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000073964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074359]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074359
AA Change: Y43C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073964
Gene: ENSMUSG00000066512
AA Change: Y43C

DomainStartEndE-ValueType
Tryp_SPc 24 253 1.49e-100 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206890
Meta Mutation Damage Score 0.2695 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Klk1b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Klk1b5 APN 7 44216504 missense probably benign 0.00
R0706:Klk1b5 UTSW 7 44218514 missense probably damaging 1.00
R1689:Klk1b5 UTSW 7 44220545 missense probably damaging 0.98
R1845:Klk1b5 UTSW 7 44220125 missense probably benign
R2153:Klk1b5 UTSW 7 44219898 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTACCCACAGCATAGATCTCCC -3'
(R):5'- TGGATAGTTTCAGCCAGTCCCACC -3'

Sequencing Primer
(F):5'- ATATATGGGTCCCTTCCCCAG -3'
(R):5'- ACCTGCCTGCCCTTCAG -3'
Posted On2013-06-12