Incidental Mutation 'R5989:Ebf1'
ID481890
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Nameearly B cell factor 1
SynonymsOlf1, O/E-1, Olf-1
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location44617317-45008091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44996171 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 565 (C565F)
Ref Sequence ENSEMBL: ENSMUSP00000104891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
Predicted Effect probably damaging
Transcript: ENSMUST00000081265
AA Change: C572F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: C572F

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101326
AA Change: C573F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: C573F

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109268
AA Change: C565F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: C565F

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Befuddled UTSW 11 44632775 missense probably damaging 0.98
Catastrophic UTSW 11 44883885 missense probably damaging 1.00
Crater_lake UTSW 11 44972908 nonsense probably null
ebby UTSW 11 44883814 missense probably damaging 1.00
Oregano UTSW 11 44869169 missense probably damaging 1.00
Oregano2 UTSW 11 44990504 splice site probably null
Realtor UTSW 11 44620547 missense probably benign 0.05
Vie UTSW 11 44972915 missense probably damaging 1.00
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R4904:Ebf1 UTSW 11 44869169 missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44992401 missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44621968 missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44991511 missense probably damaging 0.99
R8065:Ebf1 UTSW 11 44620547 missense probably benign 0.05
R8067:Ebf1 UTSW 11 44620547 missense probably benign 0.05
R8125:Ebf1 UTSW 11 44972915 missense probably damaging 1.00
R8413:Ebf1 UTSW 11 44643447 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACCCTCAGTTGTGCCATCC -3'
(R):5'- CTGGAGCAAAGTTCCTGGAG -3'

Sequencing Primer
(F):5'- AGTTGTGCCATCCAGCCC -3'
(R):5'- AGAGGGATGCTACAGACACC -3'
Posted On2017-06-26