Incidental Mutation 'R5989:Spem1'
ID481891
Institutional Source Beutler Lab
Gene Symbol Spem1
Ensembl Gene ENSMUSG00000041165
Gene Namesperm maturation 1
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69820876-69822180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69821125 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 238 (P238S)
Ref Sequence ENSEMBL: ENSMUSP00000037500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000056484] [ENSMUST00000056941] [ENSMUST00000108634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045771
AA Change: P238S

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165
AA Change: P238S

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056484
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056941
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108634
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display infertility, asthenozoospermia, teratozoospermia, and impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Spem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Spem1 APN 11 69821817 missense probably damaging 1.00
R0118:Spem1 UTSW 11 69821545 missense possibly damaging 0.92
R0487:Spem1 UTSW 11 69821865 critical splice acceptor site probably null
R0734:Spem1 UTSW 11 69821271 missense probably damaging 1.00
R2483:Spem1 UTSW 11 69821518 missense possibly damaging 0.95
R4522:Spem1 UTSW 11 69821805 critical splice donor site probably null
R4866:Spem1 UTSW 11 69820929 missense probably damaging 1.00
R5297:Spem1 UTSW 11 69820927 missense probably damaging 1.00
R5404:Spem1 UTSW 11 69820937 missense probably damaging 1.00
R5672:Spem1 UTSW 11 69821437 missense probably damaging 1.00
R6803:Spem1 UTSW 11 69821148 missense possibly damaging 0.84
R7234:Spem1 UTSW 11 69821804 critical splice donor site probably null
R7631:Spem1 UTSW 11 69821583 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGATACACCCAATCTTTGCCTG -3'
(R):5'- GATGGTCTAGAGCAACCTCC -3'

Sequencing Primer
(F):5'- CTGTCCCCTCAGCTGCG -3'
(R):5'- GACCATCCGCTTCCAGC -3'
Posted On2017-06-26