Mutagenetix > Incidental Mutation

Incidental Mutation 'R5989:Rnd2'

481892

Institutional Source

Beutler Lab

Gene Symbol

Rnd2

Ensembl Gene

ENSMUSG00000001313

Gene Name

Rho family GTPase 2

Synonyms

Rohn, Arhn

MMRRC Submission

044169-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5989 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101359001-101362679 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101359825 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 57 (L57F)

Ref Sequence

ENSEMBL: ENSMUSP00000001347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]

AlphaFold

Q9QYM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

Domain	Start	End	E-Value	Type
RHO	10	184	5.22e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040430

SMART Domains

Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	41	60	N/A	INTRINSIC
Pfam:ADH_N	89	157	8.8e-11	PFAM
Pfam:ADH_zinc_N	213	355	2.1e-21	PFAM
Pfam:ADH_zinc_N_2	245	398	6.9e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134980

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153185

Meta Mutation Damage Score

0.1630

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cartpt	T	A	13: 100,035,492 (GRCm39)	I109F	probably damaging	Het
Csmd3	G	A	15: 47,454,160 (GRCm39)	P3562L	possibly damaging	Het
Cyp2c40	T	C	19: 39,796,024 (GRCm39)	D118G	probably benign	Het
Dmrt1	T	A	19: 25,523,245 (GRCm39)	S199T	possibly damaging	Het
Drgx	A	G	14: 32,330,145 (GRCm39)	N116S	probably benign	Het
Ebf1	G	T	11: 44,886,998 (GRCm39)	C565F	probably damaging	Het
Ggnbp1	A	G	17: 27,248,721 (GRCm39)	R97G	probably benign	Het
Gm10271	A	T	10: 116,808,497 (GRCm39)	F6L	probably damaging	Het
Gm42417	A	G	1: 36,571,273 (GRCm39)	F183L	probably damaging	Het
Ipcef1	A	T	10: 6,929,532 (GRCm39)	Y69*	probably null	Het
Lcp1	A	T	14: 75,436,827 (GRCm39)	M58L	probably benign	Het
Mtif2	A	G	11: 29,480,098 (GRCm39)	T55A	probably damaging	Het
Nefm	A	G	14: 68,361,778 (GRCm39)	V162A	probably benign	Het
Nmral1	G	A	16: 4,536,902 (GRCm39)		probably benign	Het
Or5h23	A	T	16: 58,906,697 (GRCm39)	W50R	probably benign	Het
Panx2	T	C	15: 88,944,455 (GRCm39)	L60P	probably damaging	Het
Prkag3	T	C	1: 74,780,433 (GRCm39)	N411D	probably benign	Het
Ramacl	G	A	13: 67,056,050 (GRCm39)	M14I	probably damaging	Het
Rttn	G	A	18: 88,991,750 (GRCm39)	D110N	probably damaging	Het
Sfta2	G	T	17: 35,960,672 (GRCm39)		probably benign	Het
Slc17a3	A	G	13: 24,026,411 (GRCm39)		probably benign	Het
Spem1	G	A	11: 69,711,951 (GRCm39)	P238S	possibly damaging	Het
Tmem200c	G	T	17: 69,144,431 (GRCm39)		probably benign	Het
Trpm2	A	G	10: 77,795,734 (GRCm39)	F131S	probably damaging	Het
Vps51	A	G	19: 6,126,402 (GRCm39)	S117P	probably damaging	Het
Zbtb21	G	A	16: 97,752,699 (GRCm39)	P556L	probably damaging	Het

Other mutations in Rnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Rnd2	APN	11	101,362,017 (GRCm39)	missense	possibly damaging	0.81
IGL01964:Rnd2	APN	11	101,361,632 (GRCm39)	splice site	probably null
Atkins	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R1581:Rnd2	UTSW	11	101,362,022 (GRCm39)	missense	probably benign
R4606:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4797:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4824:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4825:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4931:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5005:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5078:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5079:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5402:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5405:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5497:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5498:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5501:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5534:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5619:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5666:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5669:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5670:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5671:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5786:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5788:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5844:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5845:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5857:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5991:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5992:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6018:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6019:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6020:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6122:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6144:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6148:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6208:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6209:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6226:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6230:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6332:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6333:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6335:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6491:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6541:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6605:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6606:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6607:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6677:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6678:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6726:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6796:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6797:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R8415:Rnd2	UTSW	11	101,362,011 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGCCTCAGACCAACTTCTG -3'
(R):5'- CCTACGTGGTTTCTGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'

Posted On

2017-06-26