Incidental Mutation 'R5989:Gm10767'
ID481894
Institutional Source Beutler Lab
Gene Symbol Gm10767
Ensembl Gene ENSMUSG00000074826
Gene Namepredicted gene 10767
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location66904914-66909236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66907986 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 14 (M14I)
Ref Sequence ENSEMBL: ENSMUSP00000133647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021991] [ENSMUST00000021993] [ENSMUST00000099412] [ENSMUST00000168767] [ENSMUST00000173158]
Predicted Effect probably benign
Transcript: ENSMUST00000021991
SMART Domains Protein: ENSMUSP00000021991
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Mterf 161 196 1.63e3 SMART
Mterf 201 231 7.37e-1 SMART
Mterf 236 267 4.68e-3 SMART
Mterf 272 303 2.12e-1 SMART
Mterf 308 339 4.11e1 SMART
Mterf 340 370 9.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021993
SMART Domains Protein: ENSMUSP00000021993
Gene: ENSMUSG00000021520

DomainStartEndE-ValueType
Pfam:UCR_14kD 8 106 1.2e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099412
AA Change: M14I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133648
Gene: ENSMUSG00000074826
AA Change: M14I

DomainStartEndE-ValueType
Pfam:RAM 9 89 1.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168767
AA Change: M14I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133647
Gene: ENSMUSG00000074826
AA Change: M14I

DomainStartEndE-ValueType
Pfam:RAM 10 87 5.5e-24 PFAM
low complexity region 89 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173158
SMART Domains Protein: ENSMUSP00000134032
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173891
SMART Domains Protein: ENSMUSP00000133330
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
Pfam:mTERF 2 67 2.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223875
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Gm10767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Gm10767 APN 13 66908213 intron probably benign
R1950:Gm10767 UTSW 13 66907205 intron probably benign
R2000:Gm10767 UTSW 13 66908150 missense possibly damaging 0.94
R7823:Gm10767 UTSW 13 66907287 intron probably benign
Predicted Primers PCR Primer
(F):5'- GACATATACATGTGATGCATTGGC -3'
(R):5'- CCACTGATTTGACCGGTTGTC -3'

Sequencing Primer
(F):5'- GCATTGGCACACCCCTC -3'
(R):5'- CCGGTTGTCAGTTGGCCATC -3'
Posted On2017-06-26