Incidental Mutation 'R5989:Cartpt'
ID481895
Institutional Source Beutler Lab
Gene Symbol Cartpt
Ensembl Gene ENSMUSG00000021647
Gene NameCART prepropeptide
SynonymsCart
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location99898489-99901091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99898984 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 109 (I109F)
Ref Sequence ENSEMBL: ENSMUSP00000022150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022150] [ENSMUST00000224142]
Predicted Effect probably damaging
Transcript: ENSMUST00000022150
AA Change: I109F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022150
Gene: ENSMUSG00000021647
AA Change: I109F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:CART 64 129 1.6e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224142
AA Change: I96F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes preproprotein isoforms that are processed into multiple biologically active peptides. Expression of this gene is regulated by cocaine and other drugs, and is associated with feeding/appetite and stress response. Mice lacking the encoded protein are predisposed to obesity. Deficiency of the encoded protein in mice results in pancreatic islet dysfunction, impaired insulin secretion and glucose intolerance. Alternative splicing results in multiple transcript variants encoding different isoforms, which are subsequently processed into mature peptides. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice exhibit increases in food consumption, body weight, and fat mass when fed a high-fat diet, but not on a regular diet. Mice homozygous for another disruption in this gene have increased body weight at older ages, impaired insulin secretion and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Cartpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Cartpt APN 13 99900040 missense probably benign 0.10
R2203:Cartpt UTSW 13 99900625 missense probably benign 0.18
R2204:Cartpt UTSW 13 99900625 missense probably benign 0.18
R4670:Cartpt UTSW 13 99900080 critical splice acceptor site probably null
R4671:Cartpt UTSW 13 99900080 critical splice acceptor site probably null
Z1176:Cartpt UTSW 13 99899983
Predicted Primers PCR Primer
(F):5'- GGGAACGCAAACTTTATTGTTGC -3'
(R):5'- ATTGTGGTCCCTCCCCAAAG -3'

Sequencing Primer
(F):5'- ATTGTTGCTAAAGCCAGGCTC -3'
(R):5'- GGAGGGGATCAGTCATTTAAATTTC -3'
Posted On2017-06-26