Incidental Mutation 'R5989:Prrxl1'
ID481896
Institutional Source Beutler Lab
Gene Symbol Prrxl1
Ensembl Gene ENSMUSG00000041730
Gene Namepaired related homeobox protein-like 1
SynonymsDrg11
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5989 (G1)
Quality Score152.008
Status Not validated
Chromosome14
Chromosomal Location32599407-32649246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32608188 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000140337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068938] [ENSMUST00000186452] [ENSMUST00000187377] [ENSMUST00000189022] [ENSMUST00000228878]
Predicted Effect probably benign
Transcript: ENSMUST00000068938
AA Change: N116S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064107
Gene: ENSMUSG00000041730
AA Change: N116S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186452
AA Change: N116S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139756
Gene: ENSMUSG00000041730
AA Change: N116S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187377
AA Change: N116S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140687
Gene: ENSMUSG00000041730
AA Change: N116S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189022
AA Change: N116S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140337
Gene: ENSMUSG00000041730
AA Change: N116S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228878
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice had delayed projection of sensory afferent neurons in the dorsal, but not the ventral, spinal cord during embryonic development. This delayed development resulted in abnormal responses to noxious stimuli in adults, but normal locomotion and sensory motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Prrxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Prrxl1 APN 14 32605214 splice site probably benign
IGL01868:Prrxl1 APN 14 32608377 missense probably damaging 0.99
R0436:Prrxl1 UTSW 14 32608083 missense probably damaging 1.00
R1395:Prrxl1 UTSW 14 32608369 missense probably benign 0.05
R1574:Prrxl1 UTSW 14 32605324 splice site probably benign
R2093:Prrxl1 UTSW 14 32647155 intron probably benign
R3700:Prrxl1 UTSW 14 32628861 missense probably damaging 1.00
R4922:Prrxl1 UTSW 14 32608406 missense probably damaging 1.00
R4944:Prrxl1 UTSW 14 32608249 missense probably damaging 1.00
R4962:Prrxl1 UTSW 14 32647144 intron probably benign
R5512:Prrxl1 UTSW 14 32600044 missense probably damaging 0.99
R7423:Prrxl1 UTSW 14 32628821 missense probably damaging 1.00
R7790:Prrxl1 UTSW 14 32628888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATCTGTGGTCTGAAGTTC -3'
(R):5'- GCATACGTGGCTGTGTTCAG -3'

Sequencing Primer
(F):5'- TGTCGTCATGGGCCTCCTG -3'
(R):5'- CTGTGTTCAGGAGGGTCCC -3'
Posted On2017-06-26