Incidental Mutation 'R5989:Nefm'
ID481897
Institutional Source Beutler Lab
Gene Symbol Nefm
Ensembl Gene ENSMUSG00000022054
Gene Nameneurofilament, medium polypeptide
SynonymsNfm, NF160, NF-M, NF165, Nef3, neurofilament-M
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R5989 (G1)
Quality Score206.009
Status Not validated
Chromosome14
Chromosomal Location68082590-68124846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68124329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 162 (V162A)
Ref Sequence ENSEMBL: ENSMUSP00000022638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022638] [ENSMUST00000111089]
Predicted Effect probably benign
Transcript: ENSMUST00000022638
AA Change: V162A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022638
Gene: ENSMUSG00000022054
AA Change: V162A

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 2.6e-18 PFAM
Filament 98 409 1.16e-131 SMART
coiled coil region 460 533 N/A INTRINSIC
low complexity region 540 604 N/A INTRINSIC
low complexity region 608 668 N/A INTRINSIC
low complexity region 703 719 N/A INTRINSIC
low complexity region 736 754 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111089
AA Change: V162A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054
AA Change: V162A

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Nefm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Nefm APN 14 68124464 missense probably damaging 1.00
IGL02379:Nefm APN 14 68120239 intron probably benign
IGL02664:Nefm APN 14 68120215 intron probably benign
IGL03115:Nefm APN 14 68120279 intron probably benign
IGL03328:Nefm APN 14 68121290 missense probably benign 0.28
IGL03055:Nefm UTSW 14 68122909 missense probably damaging 0.98
P0025:Nefm UTSW 14 68120965 intron probably benign
R0055:Nefm UTSW 14 68121199 intron probably benign
R0055:Nefm UTSW 14 68121199 intron probably benign
R0111:Nefm UTSW 14 68124542 missense probably benign 0.43
R0240:Nefm UTSW 14 68121134 nonsense probably null
R0240:Nefm UTSW 14 68121134 nonsense probably null
R0480:Nefm UTSW 14 68124159 missense probably damaging 1.00
R0505:Nefm UTSW 14 68124159 missense probably damaging 1.00
R0565:Nefm UTSW 14 68124621 missense probably damaging 1.00
R1454:Nefm UTSW 14 68121379 missense probably damaging 1.00
R1902:Nefm UTSW 14 68124114 missense probably benign 0.02
R2680:Nefm UTSW 14 68123786 missense probably damaging 1.00
R3763:Nefm UTSW 14 68124348 missense probably damaging 1.00
R4996:Nefm UTSW 14 68121121 intron probably benign
R5426:Nefm UTSW 14 68120066 intron probably benign
R5613:Nefm UTSW 14 68121134 nonsense probably null
R7255:Nefm UTSW 14 68116000 missense probably benign 0.08
R8704:Nefm UTSW 14 68121061 missense unknown
R8775:Nefm UTSW 14 68124659 missense probably damaging 1.00
R8775-TAIL:Nefm UTSW 14 68124659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGACTGCACCTTCTTGTC -3'
(R):5'- GACTACAAACTGTCCCGCTC -3'

Sequencing Primer
(F):5'- GTCCAGCTCCACCTTAACCATC -3'
(R):5'- TGTCCCGCTCTAACGAGAAAGAG -3'
Posted On2017-06-26