Mutagenetix > Incidental Mutation

Incidental Mutation 'R5989:Lcp1'

481898

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

044169-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5989 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75199387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 58 (M58L)

Ref Sequence

ENSEMBL: ENSMUSP00000117984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000143539] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

probably benign
Transcript: ENSMUST00000122840
AA Change: M58L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124499
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125833
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130510

Predicted Effect

probably benign
Transcript: ENSMUST00000131802
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134114
AA Change: M58L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143539
AA Change: M58L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	76	4.45e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145303
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: M58L

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161819

Meta Mutation Damage Score

0.0857

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cartpt	T	A	13: 99,898,984	I109F	probably damaging	Het
Csmd3	G	A	15: 47,590,764	P3562L	possibly damaging	Het
Cyp2c40	T	C	19: 39,807,580	D118G	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Ebf1	G	T	11: 44,996,171	C565F	probably damaging	Het
Ggnbp1	A	G	17: 27,029,747	R97G	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10767	G	A	13: 66,907,986	M14I	probably damaging	Het
Gm42417	A	G	1: 36,532,192	F183L	probably damaging	Het
Ipcef1	A	T	10: 6,979,532	Y69*	probably null	Het
Mtif2	A	G	11: 29,530,098	T55A	probably damaging	Het
Nefm	A	G	14: 68,124,329	V162A	probably benign	Het
Nmral1	G	A	16: 4,719,038		probably benign	Het
Olfr191	A	T	16: 59,086,334	W50R	probably benign	Het
Panx2	T	C	15: 89,060,252	L60P	probably damaging	Het
Prkag3	T	C	1: 74,741,274	N411D	probably benign	Het
Prrxl1	A	G	14: 32,608,188	N116S	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rttn	G	A	18: 88,973,626	D110N	probably damaging	Het
Sfta2	G	T	17: 35,649,780		probably benign	Het
Slc17a3	A	G	13: 23,842,428		probably benign	Het
Spem1	G	A	11: 69,821,125	P238S	possibly damaging	Het
Tmem200c	G	T	17: 68,837,436		probably benign	Het
Trpm2	A	G	10: 77,959,900	F131S	probably damaging	Het
Vps51	A	G	19: 6,076,372	S117P	probably damaging	Het
Zbtb21	G	A	16: 97,951,499	P556L	probably damaging	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0313:Lcp1	UTSW	14	75199433	missense	probably damaging	1.00
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0811:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2045:Lcp1	UTSW	14	75200401	missense	probably benign	0.01
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R6731:Lcp1	UTSW	14	75206189	missense	probably damaging	1.00
R7346:Lcp1	UTSW	14	75210506	missense	possibly damaging	0.49
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCTATCTGGGTCAGAC -3'
(R):5'- AGCTGTAGTCAAGGAAACCAC -3'

Sequencing Primer
(F):5'- AGACCCATGCCTGGTCATC -3'
(R):5'- CAAAGGTAAGAACTGTACCAACG -3'

Posted On

2017-06-26