Incidental Mutation 'R0515:Olfr889'
ID48190
Institutional Source Beutler Lab
Gene Symbol Olfr889
Ensembl Gene ENSMUSG00000096356
Gene Nameolfactory receptor 889
SynonymsMOR162-2, GA_x6K02T2PVTD-31795028-31795957
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38115198-38121245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38116017 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000148913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072290] [ENSMUST00000211851] [ENSMUST00000217286]
Predicted Effect probably damaging
Transcript: ENSMUST00000072290
AA Change: S79P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072137
Gene: ENSMUSG00000096356
AA Change: S79P

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 4.4e-50 PFAM
Pfam:7tm_1 46 293 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213042
AA Change: S74P
Predicted Effect probably damaging
Transcript: ENSMUST00000217286
AA Change: S74P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Olfr889
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Olfr889 APN 9 38116597 missense probably benign 0.02
IGL02604:Olfr889 APN 9 38115852 nonsense probably null
IGL02727:Olfr889 APN 9 38116512 missense probably damaging 0.99
R0364:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R0387:Olfr889 UTSW 9 38115770 splice site probably null
R0409:Olfr889 UTSW 9 38116251 missense probably benign
R0693:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R1554:Olfr889 UTSW 9 38115934 missense probably benign 0.01
R1972:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R1973:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R3815:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3816:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3817:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3819:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R5532:Olfr889 UTSW 9 38116627 missense probably benign 0.12
R5775:Olfr889 UTSW 9 38116127 missense probably damaging 1.00
R5931:Olfr889 UTSW 9 38116374 missense probably benign 0.00
R6458:Olfr889 UTSW 9 38116054 missense possibly damaging 0.90
R6751:Olfr889 UTSW 9 38115975 missense probably damaging 1.00
R7168:Olfr889 UTSW 9 38116663 missense probably damaging 1.00
R7673:Olfr889 UTSW 9 38116227 missense probably benign 0.00
R7698:Olfr889 UTSW 9 38115892 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCCAGTGAGCCTTTGGTGTG -3'
(R):5'- TGGGACATGGTGACCTGGTAAAGC -3'

Sequencing Primer
(F):5'- GAATGGCTGTAGGAAATTCCTC -3'
(R):5'- CAGGGGCTTACAGATGGC -3'
Posted On2013-06-12