Incidental Mutation 'R5989:Panx2'
ID481900
Institutional Source Beutler Lab
Gene Symbol Panx2
Ensembl Gene ENSMUSG00000058441
Gene Namepannexin 2
Synonyms
MMRRC Submission 044169-MU
Accession Numbers

Genbank: NM_001002005; MGI: 1890615

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5989 (G1)
Quality Score123.008
Status Not validated
Chromosome15
Chromosomal Location89059734-89073567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89060252 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 60 (L60P)
Ref Sequence ENSEMBL: ENSMUSP00000124354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161372] [ENSMUST00000162424]
Predicted Effect probably damaging
Transcript: ENSMUST00000161372
AA Change: L60P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125514
Gene: ENSMUSG00000058441
AA Change: L60P

DomainStartEndE-ValueType
Pfam:Innexin 48 274 2.1e-11 PFAM
transmembrane domain 302 324 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162424
AA Change: L60P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124354
Gene: ENSMUSG00000058441
AA Change: L60P

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Innexin 49 263 5.6e-18 PFAM
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 490 505 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 1 are abundantly expressed in central nervous system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 1 may form cell type-specific gap junctions with distinct properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a slight protection from the neurological defects induced by ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Panx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Panx2 APN 15 89068767 missense probably damaging 0.99
IGL02112:Panx2 APN 15 89069569 missense probably benign
IGL03384:Panx2 APN 15 89068119 missense possibly damaging 0.85
F6893:Panx2 UTSW 15 89068010 missense probably damaging 1.00
R0453:Panx2 UTSW 15 89068407 missense probably damaging 1.00
R1990:Panx2 UTSW 15 89069738 missense possibly damaging 0.95
R2912:Panx2 UTSW 15 89069821 missense probably benign 0.01
R3826:Panx2 UTSW 15 89068461 missense probably damaging 1.00
R4424:Panx2 UTSW 15 89068220 missense probably benign 0.02
R4593:Panx2 UTSW 15 89067915 missense probably damaging 1.00
R5176:Panx2 UTSW 15 89060228 missense probably damaging 1.00
R5328:Panx2 UTSW 15 89068095 missense probably damaging 0.99
R5333:Panx2 UTSW 15 89068539 missense possibly damaging 0.58
R5381:Panx2 UTSW 15 89060230 missense probably damaging 1.00
R5412:Panx2 UTSW 15 89068932 missense possibly damaging 0.79
R5450:Panx2 UTSW 15 89068959 missense possibly damaging 0.74
R6255:Panx2 UTSW 15 89067618 missense probably damaging 1.00
R7585:Panx2 UTSW 15 89067966 missense probably damaging 1.00
R7685:Panx2 UTSW 15 89067770 missense possibly damaging 0.65
R7899:Panx2 UTSW 15 89068733 missense possibly damaging 0.74
R8030:Panx2 UTSW 15 89068079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAAGTCATCGCCAAC -3'
(R):5'- CCCAAGGTCTGTGATGAGAC -3'

Sequencing Primer
(F):5'- GCATCCCCGCTGACATC -3'
(R):5'- TGAGACCTGCGGGCAATG -3'
Posted On2017-06-26