Incidental Mutation 'R5989:Olfr191'
ID481902
Institutional Source Beutler Lab
Gene Symbol Olfr191
Ensembl Gene ENSMUSG00000094539
Gene Nameolfactory receptor 191
SynonymsGA_x54KRFPKG5P-55314632-55313703, MOR183-5P
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59082829-59089822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59086334 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 50 (W50R)
Ref Sequence ENSEMBL: ENSMUSP00000150473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078517] [ENSMUST00000205471] [ENSMUST00000215647]
Predicted Effect probably benign
Transcript: ENSMUST00000078517
AA Change: W50R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077604
Gene: ENSMUSG00000094539
AA Change: W50R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-47 PFAM
Pfam:7tm_1 41 290 6.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205471
AA Change: W50R
Predicted Effect probably benign
Transcript: ENSMUST00000215647
AA Change: W50R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Olfr191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr191 APN 16 59086393 missense possibly damaging 0.86
IGL01553:Olfr191 APN 16 59086322 missense probably benign 0.35
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R1367:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R1631:Olfr191 UTSW 16 59086045 missense probably benign
R1660:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R2166:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2167:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2168:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2191:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R3836:Olfr191 UTSW 16 59086223 missense possibly damaging 0.61
R4999:Olfr191 UTSW 16 59086402 missense probably damaging 1.00
R5386:Olfr191 UTSW 16 59085890 missense probably benign
R5589:Olfr191 UTSW 16 59085971 missense probably benign 0.03
R5590:Olfr191 UTSW 16 59085997 missense probably benign 0.06
R5609:Olfr191 UTSW 16 59086076 missense possibly damaging 0.96
R5965:Olfr191 UTSW 16 59086303 missense probably damaging 1.00
R6049:Olfr191 UTSW 16 59086146 nonsense probably null
R6058:Olfr191 UTSW 16 59085910 missense probably damaging 0.99
R6058:Olfr191 UTSW 16 59086429 missense probably benign
R6250:Olfr191 UTSW 16 59085832 missense probably damaging 1.00
R6319:Olfr191 UTSW 16 59086021 missense probably benign 0.08
R6473:Olfr191 UTSW 16 59086043 missense probably benign 0.09
R6524:Olfr191 UTSW 16 59086277 missense possibly damaging 0.76
R6748:Olfr191 UTSW 16 59085890 missense probably benign
R6874:Olfr191 UTSW 16 59085949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCAAGAGAAAACATTCCGTGG -3'
(R):5'- TGAGTGCTGTGTGACATCAGTC -3'

Sequencing Primer
(F):5'- GAGAAAACATTCCGTGGTTGCACTC -3'
(R):5'- GTCATTTTTCATTTCAGAGACAGCC -3'
Posted On2017-06-26