Incidental Mutation 'R5989:Ggnbp1'
ID481904
Institutional Source Beutler Lab
Gene Symbol Ggnbp1
Ensembl Gene ENSMUSG00000048731
Gene Namegametogenetin binding protein 1
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26973217-27036378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27029747 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 97 (R97G)
Ref Sequence ENSEMBL: ENSMUSP00000115777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025034] [ENSMUST00000053683] [ENSMUST00000078691] [ENSMUST00000122106] [ENSMUST00000133257]
Predicted Effect probably benign
Transcript: ENSMUST00000025034
SMART Domains Protein: ENSMUSP00000025034
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
SCOP:d1f16a_ 15 114 2e-18 SMART
PDB:2M5B|A 18 126 1e-50 PDB
Blast:BCL 33 66 2e-10 BLAST
Blast:BCL 76 126 2e-20 BLAST
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053683
AA Change: R97G

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051800
Gene: ENSMUSG00000048731
AA Change: R97G

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 6.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078691
SMART Domains Protein: ENSMUSP00000077757
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
BCL 76 175 2.2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122106
SMART Domains Protein: ENSMUSP00000113880
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Ubiquitin_3 172 260 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133257
AA Change: R97G

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731
AA Change: R97G

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133448
SMART Domains Protein: ENSMUSP00000122800
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154731
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Ggnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ggnbp1 APN 17 27029555 missense probably benign 0.22
R1978:Ggnbp1 UTSW 17 27029543 missense possibly damaging 0.95
R3721:Ggnbp1 UTSW 17 27029613 missense probably benign 0.00
R3898:Ggnbp1 UTSW 17 27025338 unclassified probably benign
R4849:Ggnbp1 UTSW 17 27032973 critical splice donor site probably null
R6192:Ggnbp1 UTSW 17 27029873 missense possibly damaging 0.54
R7619:Ggnbp1 UTSW 17 27018131 start codon destroyed probably null
R7697:Ggnbp1 UTSW 17 27030762 missense probably benign 0.00
R7999:Ggnbp1 UTSW 17 27029645 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCGGTTCTAAGAGCACTAAC -3'
(R):5'- TAGCTAGATCAGGCTACCCCAC -3'

Sequencing Primer
(F):5'- GGTTCTAAGAGCACTAACAAGCC -3'
(R):5'- AGCCCCTCACCTGTCTGAG -3'
Posted On2017-06-26