Incidental Mutation 'R5989:Dmrt1'
ID481909
Institutional Source Beutler Lab
Gene Symbol Dmrt1
Ensembl Gene ENSMUSG00000024837
Gene Namedoublesex and mab-3 related transcription factor 1
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location25505618-25604329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25545881 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 199 (S199T)
Ref Sequence ENSEMBL: ENSMUSP00000025755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025755] [ENSMUST00000087525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025755
AA Change: S199T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025755
Gene: ENSMUSG00000024837
AA Change: S199T

DomainStartEndE-ValueType
low complexity region 17 68 N/A INTRINSIC
DM 70 123 1.51e-25 SMART
Pfam:Dmrt1 128 200 2.3e-37 PFAM
low complexity region 219 226 N/A INTRINSIC
low complexity region 326 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087525
SMART Domains Protein: ENSMUSP00000084803
Gene: ENSMUSG00000024837

DomainStartEndE-ValueType
low complexity region 17 68 N/A INTRINSIC
DM 70 123 1.51e-25 SMART
Pfam:Dmrt1 128 185 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160814
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is found in a cluster with two other members of the gene family, having in common a zinc finger-like DNA-binding motif (DM domain). The DM domain is an ancient, conserved component of the vertebrate sex-determining pathway that is also a key regulator of male development in flies and nematodes. This gene exhibits a gonad-specific and sexually dimorphic expression pattern. Defective testicular development and XY feminization occur when this gene is hemizygous. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for null mutations are sterile and exhibit a complete loss of germ cells between postnatal days 7-14, disorganized seminiferous tubules, and degeneration of Leydig cells. Females are normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Cyp2c40 T C 19: 39,807,580 D118G probably benign Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Dmrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dmrt1 APN 19 25603274 missense probably damaging 0.98
IGL03167:Dmrt1 APN 19 25545893 missense possibly damaging 0.66
R0325:Dmrt1 UTSW 19 25546007 missense probably benign 0.39
R0410:Dmrt1 UTSW 19 25506103 missense probably damaging 1.00
R1834:Dmrt1 UTSW 19 25509699 missense probably damaging 0.99
R2830:Dmrt1 UTSW 19 25603294 missense probably benign 0.01
R4696:Dmrt1 UTSW 19 25603310 missense possibly damaging 0.88
R4869:Dmrt1 UTSW 19 25505855 start codon destroyed probably null 0.02
R4870:Dmrt1 UTSW 19 25505855 start codon destroyed probably null 0.02
R5477:Dmrt1 UTSW 19 25509800 missense probably benign 0.01
R6490:Dmrt1 UTSW 19 25546031 missense possibly damaging 0.50
R6590:Dmrt1 UTSW 19 25546085 missense probably benign
R6690:Dmrt1 UTSW 19 25546085 missense probably benign
R7911:Dmrt1 UTSW 19 25603328 missense probably benign 0.01
R7920:Dmrt1 UTSW 19 25506019 missense possibly damaging 0.73
R7961:Dmrt1 UTSW 19 25545881 missense possibly damaging 0.75
R8009:Dmrt1 UTSW 19 25545881 missense possibly damaging 0.75
X0064:Dmrt1 UTSW 19 25545891 missense probably damaging 1.00
Z1176:Dmrt1 UTSW 19 25559970 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGTAGAAGGCAAGATCTGTGG -3'
(R):5'- TTTCCAGTCTGAGCAGGCAC -3'

Sequencing Primer
(F):5'- GATCTGTGGACCGCCTACATTAAATC -3'
(R):5'- TAAGGTGCTGGGAGACTCC -3'
Posted On2017-06-26