Incidental Mutation 'R5989:Cyp2c40'
ID481910
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
MMRRC Submission 044169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5989 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39767071-39812814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39807580 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 118 (D118G)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
Predicted Effect probably benign
Transcript: ENSMUST00000160476
AA Change: D118G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: D118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect probably benign
Transcript: ENSMUST00000162507
AA Change: D73G

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004
AA Change: D73G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162630
AA Change: D118G

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004
AA Change: D118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163090
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cartpt T A 13: 99,898,984 I109F probably damaging Het
Csmd3 G A 15: 47,590,764 P3562L possibly damaging Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Ebf1 G T 11: 44,996,171 C565F probably damaging Het
Ggnbp1 A G 17: 27,029,747 R97G probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10767 G A 13: 66,907,986 M14I probably damaging Het
Gm42417 A G 1: 36,532,192 F183L probably damaging Het
Ipcef1 A T 10: 6,979,532 Y69* probably null Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Mtif2 A G 11: 29,530,098 T55A probably damaging Het
Nefm A G 14: 68,124,329 V162A probably benign Het
Nmral1 G A 16: 4,719,038 probably benign Het
Olfr191 A T 16: 59,086,334 W50R probably benign Het
Panx2 T C 15: 89,060,252 L60P probably damaging Het
Prkag3 T C 1: 74,741,274 N411D probably benign Het
Prrxl1 A G 14: 32,608,188 N116S probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rttn G A 18: 88,973,626 D110N probably damaging Het
Sfta2 G T 17: 35,649,780 probably benign Het
Slc17a3 A G 13: 23,842,428 probably benign Het
Spem1 G A 11: 69,821,125 P238S possibly damaging Het
Tmem200c G T 17: 68,837,436 probably benign Het
Trpm2 A G 10: 77,959,900 F131S probably damaging Het
Vps51 A G 19: 6,076,372 S117P probably damaging Het
Zbtb21 G A 16: 97,951,499 P556L probably damaging Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39812583 missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39786810 missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39803773 nonsense probably null
IGL01926:Cyp2c40 APN 19 39802655 missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39767482 missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39803802 missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39807536 missense possibly damaging 0.49
cypriot UTSW 19 39767455 missense probably damaging 0.98
R0269:Cyp2c40 UTSW 19 39773896 missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39777988 missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39778051 missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39807163 splice site probably benign
R1068:Cyp2c40 UTSW 19 39812581 missense possibly damaging 0.93
R1123:Cyp2c40 UTSW 19 39812677 missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39777971 missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39777999 missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39803771 missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39812689 missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39786806 missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39786875 missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39778041 missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39812780 unclassified probably benign
R2063:Cyp2c40 UTSW 19 39786780 missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39777954 missense probably damaging 1.00
R2413:Cyp2c40 UTSW 19 39803887 nonsense probably null
R3685:Cyp2c40 UTSW 19 39786779 missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39802529 missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39803856 missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39786846 missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39802661 splice site probably null
R4799:Cyp2c40 UTSW 19 39773849 missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39807219 missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39802591 missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39778030 missense probably damaging 1.00
R5455:Cyp2c40 UTSW 19 39803792 missense possibly damaging 0.75
R5619:Cyp2c40 UTSW 19 39803784 missense probably damaging 1.00
R6175:Cyp2c40 UTSW 19 39812560 missense probably benign 0.00
R6622:Cyp2c40 UTSW 19 39802546 missense probably damaging 1.00
R6987:Cyp2c40 UTSW 19 39812767 unclassified probably benign
R7057:Cyp2c40 UTSW 19 39807619 missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39807606 nonsense probably null
R7560:Cyp2c40 UTSW 19 39807214 missense possibly damaging 0.81
R7648:Cyp2c40 UTSW 19 39803845 makesense probably null
R7718:Cyp2c40 UTSW 19 39767338 missense probably benign 0.00
R7763:Cyp2c40 UTSW 19 39807168 missense possibly damaging 0.90
R7893:Cyp2c40 UTSW 19 39786848 missense probably damaging 0.99
R8094:Cyp2c40 UTSW 19 39802565 missense probably benign 0.17
R8094:Cyp2c40 UTSW 19 39802571 missense probably benign 0.00
R8264:Cyp2c40 UTSW 19 39807527 missense possibly damaging 0.95
R8287:Cyp2c40 UTSW 19 39767455 missense probably damaging 0.98
R8302:Cyp2c40 UTSW 19 39807622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCATGACCTCTACTCTCC -3'
(R):5'- TTCTGGCATACTGTAAGCCATG -3'

Sequencing Primer
(F):5'- CACCTTTCAGCTTGCTCTGGAAAC -3'
(R):5'- CTGGCATACTGTAAGCCATGAATAC -3'
Posted On2017-06-26