Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Rif1'

481918

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 52095844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 614 (L614V)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069794
AA Change: L614V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: L614V

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112693
AA Change: L614V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: L614V

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Meta Mutation Damage Score

0.2069

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTGCATCCAATGAGATTATTTCT -3'
(R):5'- GCAGATGTGTCCTACCTGG -3'

Sequencing Primer
(F):5'- CTAGAACTTTTGTCAGAGTCCCAGG -3'
(R):5'- AGATGTGTCCTACCTGGTGAATCAC -3'

Posted On

2017-06-26