Incidental Mutation 'R0515:Cltc'
ID48192
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0515 (G1)
Quality Score197
Status Validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86709039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 948 (S948P)
Ref Sequence ENSEMBL: ENSMUSP00000050220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect probably benign
Transcript: ENSMUST00000060766
AA Change: S948P

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: S948P

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103186
AA Change: S944P

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: S944P

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Meta Mutation Damage Score 0.6512 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5072:Cltc UTSW 11 86717968 missense possibly damaging 0.86
R5113:Cltc UTSW 11 86722321 missense probably damaging 0.98
R5126:Cltc UTSW 11 86712669 missense probably damaging 1.00
R5177:Cltc UTSW 11 86705163 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6198:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
R7621:Cltc UTSW 11 86707486 missense probably benign 0.03
R7637:Cltc UTSW 11 86730332 missense probably damaging 1.00
R7729:Cltc UTSW 11 86721648 missense probably benign
R7769:Cltc UTSW 11 86719493 missense probably damaging 1.00
R7817:Cltc UTSW 11 86725123 missense probably damaging 1.00
R8040:Cltc UTSW 11 86725205 missense probably damaging 1.00
Z1176:Cltc UTSW 11 86702632 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAATCCTCATTGTGTGCTGATGTACCT -3'
(R):5'- GTACGTGAGACCACAATCTCAAACAAGA -3'

Sequencing Primer
(F):5'- TGGTCATGTGTCAGGTAACTAC -3'
(R):5'- caagaaaaaTAAAGATGCAGTAGTGG -3'
Posted On2013-06-12