Incidental Mutation 'R5990:Patl2'
ID481921
Institutional Source Beutler Lab
Gene Symbol Patl2
Ensembl Gene ENSMUSG00000027233
Gene Nameprotein associated with topoisomerase II homolog 2 (yeast)
SynonymsPat1a, 4930424G05Rik
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122120108-122186189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122124484 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 361 (D361G)
Ref Sequence ENSEMBL: ENSMUSP00000028665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665]
Predicted Effect probably damaging
Transcript: ENSMUST00000028665
AA Change: D361G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: D361G

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Meta Mutation Damage Score 0.1337 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Atp8b3 G A 10: 80,525,697 T797M possibly damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc16 G A 9: 18,659,243 A660V unknown Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Prdm2 T C 4: 143,170,113 N102D probably damaging Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Ttll2 C A 17: 7,352,367 G54W possibly damaging Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Wdr35 A G 12: 9,016,511 D724G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Patl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Patl2 APN 2 122123810 missense probably benign 0.19
IGL01780:Patl2 APN 2 122121846 missense probably damaging 1.00
IGL02604:Patl2 APN 2 122125333 missense possibly damaging 0.80
IGL02713:Patl2 APN 2 122125847 missense probably benign 0.01
IGL02990:Patl2 APN 2 122124497 critical splice acceptor site probably null
FR4304:Patl2 UTSW 2 122126135 small insertion probably benign
FR4548:Patl2 UTSW 2 122126135 small insertion probably benign
FR4737:Patl2 UTSW 2 122126136 small insertion probably benign
FR4737:Patl2 UTSW 2 122126144 nonsense probably null
FR4737:Patl2 UTSW 2 122126145 small insertion probably benign
FR4976:Patl2 UTSW 2 122126139 small insertion probably benign
FR4976:Patl2 UTSW 2 122126141 small insertion probably benign
FR4976:Patl2 UTSW 2 122126144 small insertion probably benign
FR4976:Patl2 UTSW 2 122126145 small insertion probably benign
R0001:Patl2 UTSW 2 122125710 splice site probably benign
R0002:Patl2 UTSW 2 122125710 splice site probably benign
R0540:Patl2 UTSW 2 122126669 missense probably benign
R0570:Patl2 UTSW 2 122125308 missense probably damaging 0.99
R0607:Patl2 UTSW 2 122126669 missense probably benign
R1463:Patl2 UTSW 2 122123735 missense probably benign 0.38
R2992:Patl2 UTSW 2 122125754 missense probably damaging 0.97
R4329:Patl2 UTSW 2 122127537 missense probably benign 0.01
R4583:Patl2 UTSW 2 122126745 missense probably benign 0.00
R4737:Patl2 UTSW 2 122125306 missense probably damaging 1.00
R4965:Patl2 UTSW 2 122128848 nonsense probably null
R5091:Patl2 UTSW 2 122123802 missense probably benign 0.01
R5256:Patl2 UTSW 2 122128887 missense probably damaging 1.00
R5450:Patl2 UTSW 2 122125281 missense probably benign 0.00
R6028:Patl2 UTSW 2 122126137 missense possibly damaging 0.76
R6107:Patl2 UTSW 2 122127486 missense probably damaging 0.98
R6597:Patl2 UTSW 2 122186164 start gained probably benign
R6969:Patl2 UTSW 2 122128929 missense possibly damaging 0.52
R7131:Patl2 UTSW 2 122121782 critical splice donor site probably null
R7436:Patl2 UTSW 2 122127525 missense probably benign 0.00
R7718:Patl2 UTSW 2 122126774 intron probably null
R7852:Patl2 UTSW 2 122179109 unclassified probably benign
R8397:Patl2 UTSW 2 122125273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGCAGCACTACATTAC -3'
(R):5'- AGGTTGAGAAGCTCTTTCAGGC -3'

Sequencing Primer
(F):5'- TGGGCAGCACTACATTACATCTCTAG -3'
(R):5'- GAGAAGCTCTTTCAGGCCTTAAAAAC -3'
Posted On2017-06-26