Incidental Mutation 'R5990:Prdm2'
ID481930
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143170113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 102 (N102D)
Ref Sequence ENSEMBL: ENSMUSP00000117741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778] [ENSMUST00000134791] [ENSMUST00000154280]
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: N102D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: N102D

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118638
Predicted Effect probably damaging
Transcript: ENSMUST00000134791
AA Change: N93D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116458
Gene: ENSMUSG00000057637
AA Change: N93D

DomainStartEndE-ValueType
SET 29 137 1.35e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154280
AA Change: N102D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117741
Gene: ENSMUSG00000057637
AA Change: N102D

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
Meta Mutation Damage Score 0.8944 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Atp8b3 G A 10: 80,525,697 T797M possibly damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc16 G A 9: 18,659,243 A660V unknown Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Patl2 T C 2: 122,124,484 D361G probably damaging Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Ttll2 C A 17: 7,352,367 G54W possibly damaging Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Wdr35 A G 12: 9,016,511 D724G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATTCTAGGTCTGGGAAGTTG -3'
(R):5'- TTCAGTCCCTCATATGGTGGC -3'

Sequencing Primer
(F):5'- GTTCTTTTCAGTTACAATTAGACTGC -3'
(R):5'- AAGATTTGACAGCTTCTGTTTTCTGC -3'
Posted On2017-06-26