Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Pole'

481932

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110302144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 819 (V819D)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296]

AlphaFold

Q9WVF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000007296
AA Change: V819D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: V819D

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131887

Meta Mutation Damage Score

0.9365

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
R9626:Pole	UTSW	5	110312093	missense	possibly damaging	0.68
R9676:Pole	UTSW	5	110295565	missense	probably benign	0.00
R9720:Pole	UTSW	5	110337043	missense	probably benign	0.01
R9787:Pole	UTSW	5	110318000	critical splice donor site	probably null
R9794:Pole	UTSW	5	110318335	missense	probably benign	0.01
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAATTGGAGCAGCTATAAGGTAC -3'
(R):5'- ACTGTGCTTCCATCAAGTGTC -3'

Sequencing Primer
(F):5'- AGGTACTTAGGCTCCCCAGTATAC -3'
(R):5'- TGCTTCCATCAAGTGTCTAGTAG -3'

Posted On

2017-06-26