Incidental Mutation 'R5990:Ppp1r9a'
ID 481936
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Name protein phosphatase 1, regulatory subunit 9A
Synonyms NRB, neurabin-I, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 4902917-5165661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 5134660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 928 (H928N)
Ref Sequence ENSEMBL: ENSMUSP00000135485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
AlphaFold H3BJD6
Predicted Effect probably benign
Transcript: ENSMUST00000035813
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect probably benign
Transcript: ENSMUST00000175889
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176263
AA Change: H950N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: H950N

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177153
AA Change: H928N

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: H928N

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177456
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5,158,195 (GRCm39) missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5,157,014 (GRCm39) missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5,157,023 (GRCm39) missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5,115,322 (GRCm39) missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5,064,003 (GRCm39) missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5,158,248 (GRCm39) nonsense probably null
IGL02126:Ppp1r9a APN 6 5,156,229 (GRCm39) missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4,906,537 (GRCm39) missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5,046,015 (GRCm39) missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5,110,993 (GRCm39) splice site probably benign
R0545:Ppp1r9a UTSW 6 5,115,357 (GRCm39) missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4,906,795 (GRCm39) missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5,159,697 (GRCm39) missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5,057,557 (GRCm39) missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5,113,712 (GRCm39) nonsense probably null
R1545:Ppp1r9a UTSW 6 5,156,242 (GRCm39) critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4,906,168 (GRCm39) missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5,111,060 (GRCm39) splice site probably benign
R1834:Ppp1r9a UTSW 6 5,113,710 (GRCm39) missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4,906,348 (GRCm39) missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2227:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2898:Ppp1r9a UTSW 6 4,906,558 (GRCm39) missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5,113,674 (GRCm39) missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4,906,259 (GRCm39) unclassified probably benign
R3927:Ppp1r9a UTSW 6 5,057,531 (GRCm39) missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4,906,537 (GRCm39) missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4,905,477 (GRCm39) missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5,157,016 (GRCm39) missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5,156,177 (GRCm39) missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5,115,367 (GRCm39) missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5,159,702 (GRCm39) missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5,134,363 (GRCm39) intron probably benign
R5828:Ppp1r9a UTSW 6 5,158,200 (GRCm39) missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5,159,648 (GRCm39) missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5,157,002 (GRCm39) critical splice acceptor site probably null
R6017:Ppp1r9a UTSW 6 4,906,363 (GRCm39) missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4,905,509 (GRCm39) missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5,110,715 (GRCm39) intron probably benign
R6175:Ppp1r9a UTSW 6 4,905,639 (GRCm39) nonsense probably null
R6188:Ppp1r9a UTSW 6 5,158,113 (GRCm39) nonsense probably null
R6233:Ppp1r9a UTSW 6 5,077,610 (GRCm39) missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5,115,151 (GRCm39) missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5,057,458 (GRCm39) missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4,905,827 (GRCm39) missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5,045,949 (GRCm39) missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4,905,670 (GRCm39) missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5,134,804 (GRCm39) missense probably benign
R7238:Ppp1r9a UTSW 6 5,159,716 (GRCm39) missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5,115,378 (GRCm39) missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4,905,775 (GRCm39) missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5,143,238 (GRCm39) missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4,906,430 (GRCm39) missense probably benign
R7850:Ppp1r9a UTSW 6 4,905,894 (GRCm39) missense possibly damaging 0.77
R8029:Ppp1r9a UTSW 6 5,057,518 (GRCm39) missense possibly damaging 0.76
R8392:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R8411:Ppp1r9a UTSW 6 5,057,568 (GRCm39) missense probably damaging 1.00
R8431:Ppp1r9a UTSW 6 5,115,456 (GRCm39) missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5,115,474 (GRCm39) missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5,115,196 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r9a UTSW 6 5,134,657 (GRCm39) missense probably benign 0.00
R9096:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9097:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9131:Ppp1r9a UTSW 6 5,134,106 (GRCm39) missense possibly damaging 0.86
R9279:Ppp1r9a UTSW 6 5,113,757 (GRCm39) missense probably damaging 1.00
R9512:Ppp1r9a UTSW 6 5,115,364 (GRCm39) missense probably damaging 0.99
R9512:Ppp1r9a UTSW 6 5,113,681 (GRCm39) missense probably benign 0.27
R9567:Ppp1r9a UTSW 6 5,157,004 (GRCm39) missense probably benign 0.34
R9672:Ppp1r9a UTSW 6 5,007,889 (GRCm39) missense unknown
R9687:Ppp1r9a UTSW 6 4,905,978 (GRCm39) missense probably damaging 1.00
R9715:Ppp1r9a UTSW 6 5,045,936 (GRCm39) missense probably damaging 0.96
RF007:Ppp1r9a UTSW 6 4,906,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATGCCTTAGGTGCCTG -3'
(R):5'- GGATGAAGTGTCTCCCGAGATAG -3'

Sequencing Primer
(F):5'- TGCCTGTGTTAGCTGCAC -3'
(R):5'- TGTCTCCCGAGATAGAGGAG -3'
Posted On 2017-06-26