Incidental Mutation 'R5990:Dnah3'
ID 481943
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Name dynein, axonemal, heavy chain 3
Synonyms Dnahc3
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119521894-119694503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119672764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 546 (Y546C)
Ref Sequence ENSEMBL: ENSMUSP00000146895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: Y570C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: Y570C

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: Y546C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119,538,128 (GRCm39) missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119,550,820 (GRCm39) missense probably benign 0.02
IGL01329:Dnah3 APN 7 119,622,164 (GRCm39) missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119,525,787 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119,566,943 (GRCm39) missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119,564,753 (GRCm39) nonsense probably null
IGL01843:Dnah3 APN 7 119,542,798 (GRCm39) missense probably benign 0.12
IGL01929:Dnah3 APN 7 119,550,874 (GRCm39) nonsense probably null
IGL01994:Dnah3 APN 7 119,550,437 (GRCm39) missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 119,628,277 (GRCm39) missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119,550,494 (GRCm39) missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119,566,802 (GRCm39) missense probably benign 0.39
IGL02421:Dnah3 APN 7 119,550,215 (GRCm39) missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119,565,470 (GRCm39) missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119,538,137 (GRCm39) missense probably benign 0.19
IGL02716:Dnah3 APN 7 119,536,246 (GRCm39) missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119,564,720 (GRCm39) missense probably benign
IGL03404:Dnah3 APN 7 119,538,200 (GRCm39) missense probably damaging 1.00
R0964_Dnah3_480 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R1778_Dnah3_238 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R4658_Dnah3_599 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R0011:Dnah3 UTSW 7 119,618,924 (GRCm39) missense probably damaging 1.00
R0195:Dnah3 UTSW 7 119,676,998 (GRCm39) critical splice donor site probably null
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0312:Dnah3 UTSW 7 119,644,882 (GRCm39) missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119,564,882 (GRCm39) missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 119,685,943 (GRCm39) missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119,542,795 (GRCm39) missense probably benign 0.11
R0525:Dnah3 UTSW 7 119,527,977 (GRCm39) missense probably damaging 1.00
R0625:Dnah3 UTSW 7 119,671,110 (GRCm39) missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 119,620,138 (GRCm39) missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119,567,128 (GRCm39) missense probably benign 0.11
R0928:Dnah3 UTSW 7 119,629,274 (GRCm39) missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R0972:Dnah3 UTSW 7 119,634,563 (GRCm39) splice site probably null
R1066:Dnah3 UTSW 7 119,660,232 (GRCm39) missense probably damaging 1.00
R1082:Dnah3 UTSW 7 119,677,668 (GRCm39) missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119,522,253 (GRCm39) missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119,538,227 (GRCm39) missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 119,689,899 (GRCm39) missense probably benign 0.28
R1420:Dnah3 UTSW 7 119,551,202 (GRCm39) missense probably damaging 0.99
R1456:Dnah3 UTSW 7 119,646,853 (GRCm39) missense probably damaging 1.00
R1472:Dnah3 UTSW 7 119,670,181 (GRCm39) missense probably benign 0.12
R1617:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign 0.01
R1624:Dnah3 UTSW 7 119,618,918 (GRCm39) missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119,525,672 (GRCm39) missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119,570,402 (GRCm39) nonsense probably null
R1677:Dnah3 UTSW 7 119,527,963 (GRCm39) missense probably damaging 1.00
R1687:Dnah3 UTSW 7 119,645,009 (GRCm39) splice site probably null
R1711:Dnah3 UTSW 7 119,677,794 (GRCm39) missense probably damaging 1.00
R1738:Dnah3 UTSW 7 119,634,582 (GRCm39) missense probably damaging 1.00
R1778:Dnah3 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119,528,079 (GRCm39) splice site probably null
R1883:Dnah3 UTSW 7 119,677,142 (GRCm39) missense probably benign 0.06
R1894:Dnah3 UTSW 7 119,685,557 (GRCm39) missense probably benign 0.05
R1929:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R1988:Dnah3 UTSW 7 119,567,182 (GRCm39) missense probably damaging 0.99
R1988:Dnah3 UTSW 7 119,566,793 (GRCm39) missense possibly damaging 0.92
R2010:Dnah3 UTSW 7 119,694,400 (GRCm39) start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119,550,465 (GRCm39) missense probably damaging 1.00
R2026:Dnah3 UTSW 7 119,638,629 (GRCm39) missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119,551,132 (GRCm39) missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119,566,982 (GRCm39) missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119,551,236 (GRCm39) missense probably benign 0.02
R2199:Dnah3 UTSW 7 119,550,792 (GRCm39) missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R2350:Dnah3 UTSW 7 119,645,011 (GRCm39) splice site probably null
R2567:Dnah3 UTSW 7 119,551,920 (GRCm39) missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119,567,161 (GRCm39) missense probably benign 0.01
R2902:Dnah3 UTSW 7 119,550,722 (GRCm39) missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119,550,338 (GRCm39) missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119,550,333 (GRCm39) missense probably damaging 1.00
R3022:Dnah3 UTSW 7 119,677,704 (GRCm39) missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3402:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3403:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3919:Dnah3 UTSW 7 119,550,303 (GRCm39) missense probably damaging 1.00
R3972:Dnah3 UTSW 7 119,685,943 (GRCm39) missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4184:Dnah3 UTSW 7 119,682,516 (GRCm39) missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4239:Dnah3 UTSW 7 119,628,248 (GRCm39) nonsense probably null
R4478:Dnah3 UTSW 7 119,671,086 (GRCm39) missense probably benign 0.00
R4579:Dnah3 UTSW 7 119,608,554 (GRCm39) missense probably damaging 1.00
R4600:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign
R4649:Dnah3 UTSW 7 119,646,921 (GRCm39) missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
R4728:Dnah3 UTSW 7 119,658,589 (GRCm39) missense probably damaging 0.99
R4739:Dnah3 UTSW 7 119,677,169 (GRCm39) missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 119,678,629 (GRCm39) missense probably benign 0.00
R4785:Dnah3 UTSW 7 119,567,047 (GRCm39) missense probably benign 0.29
R4789:Dnah3 UTSW 7 119,610,295 (GRCm39) missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119,550,904 (GRCm39) nonsense probably null
R4935:Dnah3 UTSW 7 119,615,700 (GRCm39) nonsense probably null
R4946:Dnah3 UTSW 7 119,530,783 (GRCm39) missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119,555,424 (GRCm39) missense probably benign 0.03
R4984:Dnah3 UTSW 7 119,528,002 (GRCm39) missense probably benign 0.04
R5025:Dnah3 UTSW 7 119,671,128 (GRCm39) missense probably benign 0.02
R5046:Dnah3 UTSW 7 119,550,803 (GRCm39) missense probably damaging 1.00
R5056:Dnah3 UTSW 7 119,620,169 (GRCm39) missense probably damaging 1.00
R5068:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5069:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5154:Dnah3 UTSW 7 119,551,642 (GRCm39) missense probably damaging 1.00
R5208:Dnah3 UTSW 7 119,631,861 (GRCm39) missense probably damaging 1.00
R5323:Dnah3 UTSW 7 119,620,234 (GRCm39) missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119,542,871 (GRCm39) missense probably benign 0.00
R5385:Dnah3 UTSW 7 119,524,126 (GRCm39) missense probably damaging 1.00
R5391:Dnah3 UTSW 7 119,689,299 (GRCm39) missense probably benign 0.02
R5564:Dnah3 UTSW 7 119,570,689 (GRCm39) critical splice donor site probably null
R5594:Dnah3 UTSW 7 119,570,844 (GRCm39) missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119,538,288 (GRCm39) splice site probably null
R5673:Dnah3 UTSW 7 119,550,812 (GRCm39) missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 119,677,074 (GRCm39) missense probably benign 0.00
R5737:Dnah3 UTSW 7 119,658,421 (GRCm39) missense probably benign 0.03
R5766:Dnah3 UTSW 7 119,577,445 (GRCm39) missense probably damaging 1.00
R5769:Dnah3 UTSW 7 119,689,175 (GRCm39) nonsense probably null
R5789:Dnah3 UTSW 7 119,542,822 (GRCm39) missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119,530,696 (GRCm39) missense probably benign 0.00
R5841:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5851:Dnah3 UTSW 7 119,638,585 (GRCm39) missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119,538,056 (GRCm39) missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119,574,331 (GRCm39) missense probably benign 0.00
R5885:Dnah3 UTSW 7 119,668,927 (GRCm39) missense probably benign 0.10
R5898:Dnah3 UTSW 7 119,677,724 (GRCm39) missense probably benign 0.37
R5917:Dnah3 UTSW 7 119,615,749 (GRCm39) missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119,522,103 (GRCm39) missense probably benign 0.00
R6004:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.10
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6045:Dnah3 UTSW 7 119,566,745 (GRCm39) missense probably damaging 0.99
R6056:Dnah3 UTSW 7 119,629,254 (GRCm39) missense probably damaging 1.00
R6133:Dnah3 UTSW 7 119,685,469 (GRCm39) missense probably benign 0.10
R6229:Dnah3 UTSW 7 119,564,711 (GRCm39) missense probably benign 0.11
R6237:Dnah3 UTSW 7 119,608,607 (GRCm39) missense probably damaging 1.00
R6333:Dnah3 UTSW 7 119,653,856 (GRCm39) missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119,522,191 (GRCm39) splice site probably null
R6447:Dnah3 UTSW 7 119,522,277 (GRCm39) missense probably benign 0.12
R6606:Dnah3 UTSW 7 119,660,179 (GRCm39) missense probably benign 0.02
R6666:Dnah3 UTSW 7 119,670,172 (GRCm39) missense probably benign 0.16
R6733:Dnah3 UTSW 7 119,522,197 (GRCm39) missense probably benign 0.22
R6815:Dnah3 UTSW 7 119,570,950 (GRCm39) missense probably benign
R6882:Dnah3 UTSW 7 119,570,407 (GRCm39) missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 119,653,824 (GRCm39) critical splice donor site probably null
R6966:Dnah3 UTSW 7 119,631,977 (GRCm39) missense probably damaging 1.00
R7025:Dnah3 UTSW 7 119,629,233 (GRCm39) missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119,570,312 (GRCm39) missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119,521,965 (GRCm39) missense probably damaging 1.00
R7222:Dnah3 UTSW 7 119,670,746 (GRCm39) missense probably benign 0.00
R7235:Dnah3 UTSW 7 119,631,893 (GRCm39) missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119,542,856 (GRCm39) missense probably benign 0.03
R7313:Dnah3 UTSW 7 119,580,567 (GRCm39) missense probably benign 0.39
R7342:Dnah3 UTSW 7 119,629,208 (GRCm39) missense probably damaging 1.00
R7368:Dnah3 UTSW 7 119,628,239 (GRCm39) missense probably benign
R7375:Dnah3 UTSW 7 119,550,900 (GRCm39) missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119,660,183 (GRCm39) missense probably benign 0.00
R7395:Dnah3 UTSW 7 119,565,474 (GRCm39) missense
R7431:Dnah3 UTSW 7 119,650,967 (GRCm39) missense probably damaging 1.00
R7499:Dnah3 UTSW 7 119,660,135 (GRCm39) missense probably damaging 0.99
R7515:Dnah3 UTSW 7 119,672,815 (GRCm39) missense probably benign 0.21
R7564:Dnah3 UTSW 7 119,570,817 (GRCm39) missense probably benign
R7618:Dnah3 UTSW 7 119,577,601 (GRCm39) missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119,566,657 (GRCm39) missense
R7728:Dnah3 UTSW 7 119,538,051 (GRCm39) missense probably damaging 1.00
R7757:Dnah3 UTSW 7 119,570,438 (GRCm39) splice site probably null
R7757:Dnah3 UTSW 7 119,670,793 (GRCm39) missense probably benign
R7774:Dnah3 UTSW 7 119,550,975 (GRCm39) nonsense probably null
R7804:Dnah3 UTSW 7 119,610,235 (GRCm39) missense probably damaging 1.00
R7804:Dnah3 UTSW 7 119,551,841 (GRCm39) missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119,550,927 (GRCm39) missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119,566,775 (GRCm39) missense
R7903:Dnah3 UTSW 7 119,641,351 (GRCm39) missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R7989:Dnah3 UTSW 7 119,677,012 (GRCm39) missense probably benign
R8142:Dnah3 UTSW 7 119,660,189 (GRCm39) missense probably benign 0.00
R8164:Dnah3 UTSW 7 119,566,837 (GRCm39) missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119,525,636 (GRCm39) missense probably benign 0.01
R8313:Dnah3 UTSW 7 119,550,375 (GRCm39) missense probably benign 0.38
R8338:Dnah3 UTSW 7 119,671,104 (GRCm39) missense probably benign 0.01
R8355:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119,551,728 (GRCm39) missense probably damaging 1.00
R8411:Dnah3 UTSW 7 119,610,253 (GRCm39) missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8483:Dnah3 UTSW 7 119,536,253 (GRCm39) missense probably benign 0.00
R8531:Dnah3 UTSW 7 119,550,591 (GRCm39) missense probably damaging 1.00
R8885:Dnah3 UTSW 7 119,561,375 (GRCm39) missense
R8912:Dnah3 UTSW 7 119,689,869 (GRCm39) missense probably benign 0.06
R8966:Dnah3 UTSW 7 119,549,881 (GRCm39) nonsense probably null
R8982:Dnah3 UTSW 7 119,536,294 (GRCm39) missense probably damaging 1.00
R9043:Dnah3 UTSW 7 119,551,272 (GRCm39) missense probably benign
R9053:Dnah3 UTSW 7 119,618,987 (GRCm39) missense possibly damaging 0.67
R9059:Dnah3 UTSW 7 119,684,368 (GRCm39) missense probably benign 0.01
R9182:Dnah3 UTSW 7 119,684,351 (GRCm39) missense probably damaging 0.98
R9365:Dnah3 UTSW 7 119,566,859 (GRCm39) missense
R9383:Dnah3 UTSW 7 119,646,819 (GRCm39) missense probably benign 0.23
R9430:Dnah3 UTSW 7 119,628,205 (GRCm39) missense probably damaging 1.00
R9449:Dnah3 UTSW 7 119,551,473 (GRCm39) missense probably benign 0.12
R9462:Dnah3 UTSW 7 119,551,523 (GRCm39) missense probably benign 0.05
R9505:Dnah3 UTSW 7 119,644,912 (GRCm39) missense probably damaging 1.00
R9559:Dnah3 UTSW 7 119,650,951 (GRCm39) missense probably benign 0.07
R9562:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9565:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9609:Dnah3 UTSW 7 119,670,236 (GRCm39) missense probably damaging 0.98
R9622:Dnah3 UTSW 7 119,561,356 (GRCm39) missense
R9633:Dnah3 UTSW 7 119,550,216 (GRCm39) missense probably benign
R9654:Dnah3 UTSW 7 119,641,396 (GRCm39) nonsense probably null
R9665:Dnah3 UTSW 7 119,644,981 (GRCm39) missense probably benign 0.01
R9681:Dnah3 UTSW 7 119,677,611 (GRCm39) missense probably benign 0.04
R9717:Dnah3 UTSW 7 119,574,299 (GRCm39) missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 119,610,096 (GRCm39) missense probably null 1.00
Z1088:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119,567,026 (GRCm39) missense
Z1177:Dnah3 UTSW 7 119,607,085 (GRCm39) missense probably benign
Z1177:Dnah3 UTSW 7 119,567,124 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCTGAACTTGAGTCCTGTC -3'
(R):5'- GAGTCCGCACCTAAGAATGAC -3'

Sequencing Primer
(F):5'- TCAACTTAGCAGTGGGAAAGTTACAC -3'
(R):5'- GTCCGCACCTAAGAATGACTTCTG -3'
Posted On 2017-06-26