Incidental Mutation 'R5990:Muc16'
ID 481949
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009, Gm21044
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18406751-18585826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18570539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 660 (A660V)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: A660V
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,419,803 (GRCm39) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,406,839 (GRCm39) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,409,996 (GRCm39) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,409,849 (GRCm39) critical splice donor site probably null
Brimming UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
Runneymeade UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
slimey UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
viscous UTSW 9 18,556,028 (GRCm39) missense unknown
R0400:Muc16 UTSW 9 18,421,830 (GRCm39) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,421,773 (GRCm39) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,408,729 (GRCm39) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,409,126 (GRCm39) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,558,442 (GRCm39) missense unknown
R6024:Muc16 UTSW 9 18,557,967 (GRCm39) missense unknown
R6026:Muc16 UTSW 9 18,571,154 (GRCm39) missense unknown
R6028:Muc16 UTSW 9 18,568,472 (GRCm39) missense unknown
R6083:Muc16 UTSW 9 18,568,508 (GRCm39) missense unknown
R6089:Muc16 UTSW 9 18,554,548 (GRCm39) missense unknown
R6109:Muc16 UTSW 9 18,566,655 (GRCm39) missense unknown
R6127:Muc16 UTSW 9 18,569,174 (GRCm39) missense unknown
R6130:Muc16 UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,409,093 (GRCm39) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,559,114 (GRCm39) missense unknown
R6164:Muc16 UTSW 9 18,469,675 (GRCm39) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,565,769 (GRCm39) missense unknown
R6192:Muc16 UTSW 9 18,569,985 (GRCm39) missense unknown
R6217:Muc16 UTSW 9 18,566,742 (GRCm39) missense unknown
R6232:Muc16 UTSW 9 18,568,294 (GRCm39) missense unknown
R6246:Muc16 UTSW 9 18,488,363 (GRCm39) splice site probably null
R6255:Muc16 UTSW 9 18,566,895 (GRCm39) missense unknown
R6280:Muc16 UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,555,685 (GRCm39) missense unknown
R6287:Muc16 UTSW 9 18,570,330 (GRCm39) missense unknown
R6307:Muc16 UTSW 9 18,558,884 (GRCm39) missense unknown
R6310:Muc16 UTSW 9 18,553,246 (GRCm39) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,553,115 (GRCm39) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,572,004 (GRCm39) missense unknown
R6345:Muc16 UTSW 9 18,566,222 (GRCm39) missense unknown
R6349:Muc16 UTSW 9 18,568,625 (GRCm39) missense unknown
R6366:Muc16 UTSW 9 18,557,340 (GRCm39) missense unknown
R6393:Muc16 UTSW 9 18,558,695 (GRCm39) nonsense probably null
R6440:Muc16 UTSW 9 18,552,655 (GRCm39) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,553,017 (GRCm39) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,551,812 (GRCm39) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,461,973 (GRCm39) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,548,621 (GRCm39) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,473,858 (GRCm39) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,478,011 (GRCm39) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,548,866 (GRCm39) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,520,772 (GRCm39) splice site probably null
R6615:Muc16 UTSW 9 18,558,484 (GRCm39) missense unknown
R6625:Muc16 UTSW 9 18,571,574 (GRCm39) missense unknown
R6668:Muc16 UTSW 9 18,551,681 (GRCm39) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,552,587 (GRCm39) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,553,366 (GRCm39) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,477,986 (GRCm39) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,471,282 (GRCm39) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,449,206 (GRCm39) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,570,065 (GRCm39) nonsense probably null
R6894:Muc16 UTSW 9 18,406,872 (GRCm39) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,553,959 (GRCm39) missense unknown
R6919:Muc16 UTSW 9 18,571,595 (GRCm39) missense unknown
R6939:Muc16 UTSW 9 18,549,833 (GRCm39) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,551,825 (GRCm39) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,556,322 (GRCm39) missense unknown
R6977:Muc16 UTSW 9 18,556,633 (GRCm39) missense unknown
R6996:Muc16 UTSW 9 18,557,193 (GRCm39) missense unknown
R7011:Muc16 UTSW 9 18,548,839 (GRCm39) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,548,747 (GRCm39) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,406,914 (GRCm39) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,569,532 (GRCm39) missense unknown
R7021:Muc16 UTSW 9 18,462,127 (GRCm39) splice site probably null
R7021:Muc16 UTSW 9 18,466,215 (GRCm39) missense unknown
R7038:Muc16 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
R7057:Muc16 UTSW 9 18,557,375 (GRCm39) missense unknown
R7058:Muc16 UTSW 9 18,551,051 (GRCm39) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,569,317 (GRCm39) missense unknown
R7067:Muc16 UTSW 9 18,569,547 (GRCm39) missense unknown
R7070:Muc16 UTSW 9 18,557,219 (GRCm39) nonsense probably null
R7074:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7085:Muc16 UTSW 9 18,556,145 (GRCm39) missense unknown
R7088:Muc16 UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,566,529 (GRCm39) missense unknown
R7126:Muc16 UTSW 9 18,552,512 (GRCm39) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,554,300 (GRCm39) missense unknown
R7145:Muc16 UTSW 9 18,566,876 (GRCm39) missense unknown
R7179:Muc16 UTSW 9 18,553,304 (GRCm39) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,585,750 (GRCm39) missense unknown
R7211:Muc16 UTSW 9 18,409,866 (GRCm39) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,552,712 (GRCm39) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,555,372 (GRCm39) nonsense probably null
R7221:Muc16 UTSW 9 18,553,495 (GRCm39) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,567,768 (GRCm39) missense unknown
R7326:Muc16 UTSW 9 18,496,309 (GRCm39) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,554,316 (GRCm39) missense unknown
R7387:Muc16 UTSW 9 18,553,016 (GRCm39) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,550,832 (GRCm39) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,549,038 (GRCm39) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,553,258 (GRCm39) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,519,289 (GRCm39) missense
R7484:Muc16 UTSW 9 18,558,064 (GRCm39) missense unknown
R7487:Muc16 UTSW 9 18,496,095 (GRCm39) missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18,556,385 (GRCm39) missense unknown
R7515:Muc16 UTSW 9 18,550,958 (GRCm39) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,549,431 (GRCm39) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,566,747 (GRCm39) missense unknown
R7538:Muc16 UTSW 9 18,553,427 (GRCm39) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,556,028 (GRCm39) missense unknown
R7566:Muc16 UTSW 9 18,549,925 (GRCm39) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,556,910 (GRCm39) missense unknown
R7594:Muc16 UTSW 9 18,556,358 (GRCm39) missense unknown
R7629:Muc16 UTSW 9 18,478,081 (GRCm39) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,519,018 (GRCm39) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,469,723 (GRCm39) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,516,578 (GRCm39) missense
R7727:Muc16 UTSW 9 18,571,538 (GRCm39) missense unknown
R7743:Muc16 UTSW 9 18,568,773 (GRCm39) missense unknown
R7744:Muc16 UTSW 9 18,496,392 (GRCm39) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,491,870 (GRCm39) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,571,803 (GRCm39) missense unknown
R7805:Muc16 UTSW 9 18,549,789 (GRCm39) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,506,519 (GRCm39) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,552,069 (GRCm39) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,551,801 (GRCm39) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,553,990 (GRCm39) missense unknown
R7885:Muc16 UTSW 9 18,550,760 (GRCm39) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,497,278 (GRCm39) missense probably benign 0.03
R7899:Muc16 UTSW 9 18,551,993 (GRCm39) missense probably benign 0.01
R7904:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7921:Muc16 UTSW 9 18,570,614 (GRCm39) missense unknown
R7922:Muc16 UTSW 9 18,496,121 (GRCm39) missense probably benign 0.16
R7948:Muc16 UTSW 9 18,553,786 (GRCm39) missense unknown
R7957:Muc16 UTSW 9 18,554,767 (GRCm39) missense unknown
R7972:Muc16 UTSW 9 18,557,060 (GRCm39) nonsense probably null
R7992:Muc16 UTSW 9 18,567,725 (GRCm39) missense unknown
R7998:Muc16 UTSW 9 18,551,188 (GRCm39) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,566,171 (GRCm39) missense unknown
R8033:Muc16 UTSW 9 18,547,902 (GRCm39) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,570,347 (GRCm39) missense unknown
R8058:Muc16 UTSW 9 18,571,298 (GRCm39) nonsense probably null
R8088:Muc16 UTSW 9 18,430,596 (GRCm39) nonsense probably null
R8095:Muc16 UTSW 9 18,496,126 (GRCm39) nonsense probably null
R8111:Muc16 UTSW 9 18,503,925 (GRCm39) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,570,033 (GRCm39) missense unknown
R8117:Muc16 UTSW 9 18,420,206 (GRCm39) nonsense probably null
R8137:Muc16 UTSW 9 18,556,972 (GRCm39) missense unknown
R8196:Muc16 UTSW 9 18,556,630 (GRCm39) missense unknown
R8218:Muc16 UTSW 9 18,548,315 (GRCm39) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,554,273 (GRCm39) missense unknown
R8313:Muc16 UTSW 9 18,436,443 (GRCm39) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,569,339 (GRCm39) missense unknown
R8342:Muc16 UTSW 9 18,569,981 (GRCm39) missense unknown
R8351:Muc16 UTSW 9 18,571,181 (GRCm39) missense unknown
R8356:Muc16 UTSW 9 18,570,074 (GRCm39) missense unknown
R8360:Muc16 UTSW 9 18,436,554 (GRCm39) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,430,926 (GRCm39) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,448,807 (GRCm39) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,569,220 (GRCm39) missense unknown
R8463:Muc16 UTSW 9 18,570,435 (GRCm39) missense unknown
R8466:Muc16 UTSW 9 18,554,444 (GRCm39) missense unknown
R8512:Muc16 UTSW 9 18,549,488 (GRCm39) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,430,927 (GRCm39) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,552,233 (GRCm39) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,557,744 (GRCm39) missense unknown
R8680:Muc16 UTSW 9 18,556,015 (GRCm39) missense unknown
R8720:Muc16 UTSW 9 18,552,896 (GRCm39) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,571,346 (GRCm39) missense unknown
R8736:Muc16 UTSW 9 18,462,139 (GRCm39) nonsense probably null
R8739:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,567,353 (GRCm39) missense unknown
R8830:Muc16 UTSW 9 18,557,365 (GRCm39) missense unknown
R8871:Muc16 UTSW 9 18,567,344 (GRCm39) missense unknown
R8884:Muc16 UTSW 9 18,555,496 (GRCm39) missense unknown
R8923:Muc16 UTSW 9 18,549,972 (GRCm39) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,558,529 (GRCm39) missense unknown
R8949:Muc16 UTSW 9 18,432,221 (GRCm39) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,462,981 (GRCm39) nonsense probably null
R8997:Muc16 UTSW 9 18,518,763 (GRCm39) intron probably benign
R9013:Muc16 UTSW 9 18,424,069 (GRCm39) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,550,015 (GRCm39) small insertion probably benign
R9036:Muc16 UTSW 9 18,555,975 (GRCm39) missense unknown
R9040:Muc16 UTSW 9 18,556,082 (GRCm39) nonsense probably null
R9065:Muc16 UTSW 9 18,554,305 (GRCm39) missense unknown
R9089:Muc16 UTSW 9 18,555,846 (GRCm39) missense unknown
R9098:Muc16 UTSW 9 18,554,975 (GRCm39) missense unknown
R9100:Muc16 UTSW 9 18,556,966 (GRCm39) missense unknown
R9128:Muc16 UTSW 9 18,558,878 (GRCm39) missense unknown
R9169:Muc16 UTSW 9 18,567,824 (GRCm39) missense unknown
R9180:Muc16 UTSW 9 18,554,038 (GRCm39) missense unknown
R9191:Muc16 UTSW 9 18,556,106 (GRCm39) missense unknown
R9203:Muc16 UTSW 9 18,462,984 (GRCm39) missense unknown
R9208:Muc16 UTSW 9 18,419,833 (GRCm39) missense probably damaging 0.99
R9232:Muc16 UTSW 9 18,567,336 (GRCm39) missense unknown
R9240:Muc16 UTSW 9 18,449,309 (GRCm39) missense unknown
R9254:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9330:Muc16 UTSW 9 18,552,332 (GRCm39) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,571,511 (GRCm39) missense unknown
R9358:Muc16 UTSW 9 18,553,520 (GRCm39) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9403:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,553,102 (GRCm39) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,483,937 (GRCm39) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,559,028 (GRCm39) missense unknown
R9442:Muc16 UTSW 9 18,566,624 (GRCm39) missense unknown
R9453:Muc16 UTSW 9 18,572,061 (GRCm39) missense unknown
R9467:Muc16 UTSW 9 18,508,331 (GRCm39) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,568,149 (GRCm39) nonsense probably null
R9519:Muc16 UTSW 9 18,498,216 (GRCm39) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,497,314 (GRCm39) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,569,934 (GRCm39) missense unknown
R9583:Muc16 UTSW 9 18,549,973 (GRCm39) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,567,147 (GRCm39) missense unknown
R9638:Muc16 UTSW 9 18,550,626 (GRCm39) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,553,762 (GRCm39) missense unknown
R9652:Muc16 UTSW 9 18,498,178 (GRCm39) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,567,285 (GRCm39) missense unknown
R9682:Muc16 UTSW 9 18,553,874 (GRCm39) missense unknown
R9765:Muc16 UTSW 9 18,548,494 (GRCm39) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,552,383 (GRCm39) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,548,153 (GRCm39) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,570,675 (GRCm39) missense unknown
R9782:Muc16 UTSW 9 18,548,066 (GRCm39) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,569,157 (GRCm39) nonsense probably null
Z1177:Muc16 UTSW 9 18,448,867 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGTGTAAATGTCTGTGTTCCACTG -3'
(R):5'- TCTTGCCAGATCAGAAGACACC -3'

Sequencing Primer
(F):5'- AGATCTTTGGAAGTTACCATGTTTG -3'
(R):5'- GATCAGAAGACACCACACTTTCATC -3'
Posted On 2017-06-26