Incidental Mutation 'R5990:Kiss1r'
ID 481957
Institutional Source Beutler Lab
Gene Symbol Kiss1r
Ensembl Gene ENSMUSG00000035773
Gene Name KISS1 receptor
Synonyms Gpr54
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79752805-79758107 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79754541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000151936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000171416] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000218970] [ENSMUST00000219745] [ENSMUST00000219867]
AlphaFold Q91V45
Predicted Effect probably benign
Transcript: ENSMUST00000045529
AA Change: T12A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773
AA Change: T12A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045628
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171416
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect probably benign
Transcript: ENSMUST00000219745
AA Change: T12A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a galanin-like G protein-coupled receptor that binds metastin, a peptide encoded by the metastasis suppressor gene KISS1. The tissue distribution of the expressed gene suggests that it is involved in the regulation of endocrine function, and this is supported by the finding that this gene appears to play a role in the onset of puberty. Mutations in this gene have been associated with hypogonadotropic hypogonadism and central precocious puberty. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in male and female infertility associated with abnormal sexual maturation and hypogonadotropic hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Kiss1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Kiss1r APN 10 79,754,550 (GRCm39) missense possibly damaging 0.67
IGL00954:Kiss1r APN 10 79,757,834 (GRCm39) missense probably damaging 0.99
IGL01370:Kiss1r APN 10 79,754,658 (GRCm39) missense probably benign 0.01
locked UTSW 10 79,754,688 (GRCm39) missense probably damaging 1.00
R0111:Kiss1r UTSW 10 79,754,523 (GRCm39) missense possibly damaging 0.89
R1759:Kiss1r UTSW 10 79,757,612 (GRCm39) missense probably damaging 1.00
R2348:Kiss1r UTSW 10 79,757,654 (GRCm39) missense probably benign 0.34
R4654:Kiss1r UTSW 10 79,757,624 (GRCm39) missense probably damaging 1.00
R5015:Kiss1r UTSW 10 79,754,641 (GRCm39) missense probably damaging 1.00
R5072:Kiss1r UTSW 10 79,754,596 (GRCm39) nonsense probably null
R5073:Kiss1r UTSW 10 79,754,596 (GRCm39) nonsense probably null
R5074:Kiss1r UTSW 10 79,754,596 (GRCm39) nonsense probably null
R5140:Kiss1r UTSW 10 79,757,461 (GRCm39) missense probably damaging 1.00
R5253:Kiss1r UTSW 10 79,756,584 (GRCm39) missense probably damaging 1.00
R6625:Kiss1r UTSW 10 79,755,368 (GRCm39) missense possibly damaging 0.72
R7045:Kiss1r UTSW 10 79,755,259 (GRCm39) critical splice acceptor site probably null
R7051:Kiss1r UTSW 10 79,754,688 (GRCm39) missense probably damaging 1.00
R7161:Kiss1r UTSW 10 79,755,323 (GRCm39) missense probably damaging 1.00
R9108:Kiss1r UTSW 10 79,754,336 (GRCm39) intron probably benign
R9165:Kiss1r UTSW 10 79,756,605 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAAAAGTGGCCGCTGCGAAG -3'
(R):5'- CGGCAGATAACGTAGATGACC -3'

Sequencing Primer
(F):5'- AGGAGCCTCTTTCCAGCC -3'
(R):5'- GTAGATGACCAATGAGTTTCCGACC -3'
Posted On 2017-06-26