Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Atp8b3'

481958

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80525697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 797 (T797M)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020383
AA Change: T797M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T797M

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGTTCACATCGTTGGCTCC -3'
(R):5'- ACAGAGATGCAGGCCTAGTG -3'

Sequencing Primer
(F):5'- GTTGGCTCCATCTCCGATG -3'
(R):5'- ATGCAGGCCTAGTGACCCAAG -3'

Posted On

2017-06-26