Incidental Mutation 'R5990:Atp8b3'
ID481958
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80525697 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 797 (T797M)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020383
AA Change: T797M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T797M

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc16 G A 9: 18,659,243 A660V unknown Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Patl2 T C 2: 122,124,484 D361G probably damaging Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Prdm2 T C 4: 143,170,113 N102D probably damaging Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Ttll2 C A 17: 7,352,367 G54W possibly damaging Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Wdr35 A G 12: 9,016,511 D724G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGTTCACATCGTTGGCTCC -3'
(R):5'- ACAGAGATGCAGGCCTAGTG -3'

Sequencing Primer
(F):5'- GTTGGCTCCATCTCCGATG -3'
(R):5'- ATGCAGGCCTAGTGACCCAAG -3'
Posted On2017-06-26