Incidental Mutation 'R5990:Zfp735'
ID 481962
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Name zinc finger protein 735
Synonyms 1700012C15Rik
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73579604-73604624 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73581174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
AlphaFold B1ARH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000080407
AA Change: D70E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: D70E

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73,602,192 (GRCm39) missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73,602,386 (GRCm39) missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73,601,305 (GRCm39) missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73,581,191 (GRCm39) missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73,602,254 (GRCm39) missense probably benign 0.01
IGL02238:Zfp735 APN 11 73,601,319 (GRCm39) missense probably benign 0.00
IGL02505:Zfp735 APN 11 73,580,626 (GRCm39) missense probably benign 0.03
IGL02740:Zfp735 APN 11 73,601,412 (GRCm39) missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73,601,755 (GRCm39) missense probably benign 0.00
bananaquit UTSW 11 73,601,412 (GRCm39) nonsense probably null
bescher UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
Galvanic UTSW 11 73,602,504 (GRCm39) nonsense probably null
grassquit UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R0114:Zfp735 UTSW 11 73,601,488 (GRCm39) missense probably benign 0.33
R0217:Zfp735 UTSW 11 73,602,112 (GRCm39) missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73,602,909 (GRCm39) missense probably benign 0.04
R1421:Zfp735 UTSW 11 73,601,523 (GRCm39) missense probably benign
R1460:Zfp735 UTSW 11 73,603,159 (GRCm39) missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73,601,305 (GRCm39) missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73,601,470 (GRCm39) missense probably benign
R1676:Zfp735 UTSW 11 73,602,301 (GRCm39) missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73,602,589 (GRCm39) missense probably benign 0.01
R1871:Zfp735 UTSW 11 73,601,412 (GRCm39) nonsense probably null
R1931:Zfp735 UTSW 11 73,602,677 (GRCm39) missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73,601,851 (GRCm39) missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73,602,223 (GRCm39) nonsense probably null
R2227:Zfp735 UTSW 11 73,602,222 (GRCm39) missense possibly damaging 0.53
R3552:Zfp735 UTSW 11 73,602,067 (GRCm39) nonsense probably null
R3856:Zfp735 UTSW 11 73,602,282 (GRCm39) missense probably benign 0.01
R3925:Zfp735 UTSW 11 73,601,950 (GRCm39) missense probably benign 0.33
R4572:Zfp735 UTSW 11 73,580,611 (GRCm39) missense probably benign 0.02
R4585:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73,602,031 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,682 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,681 (GRCm39) missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73,602,939 (GRCm39) missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73,601,419 (GRCm39) nonsense probably null
R5516:Zfp735 UTSW 11 73,601,640 (GRCm39) missense probably benign
R5654:Zfp735 UTSW 11 73,602,964 (GRCm39) missense possibly damaging 0.71
R6332:Zfp735 UTSW 11 73,602,504 (GRCm39) nonsense probably null
R6427:Zfp735 UTSW 11 73,581,140 (GRCm39) missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73,602,478 (GRCm39) missense probably benign 0.33
R6820:Zfp735 UTSW 11 73,579,783 (GRCm39) start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73,601,880 (GRCm39) missense probably benign 0.08
R6941:Zfp735 UTSW 11 73,581,159 (GRCm39) missense probably benign 0.33
R7335:Zfp735 UTSW 11 73,602,379 (GRCm39) missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73,602,002 (GRCm39) missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73,581,154 (GRCm39) missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73,601,933 (GRCm39) missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73,601,629 (GRCm39) missense probably benign 0.00
R8005:Zfp735 UTSW 11 73,603,140 (GRCm39) nonsense probably null
R8500:Zfp735 UTSW 11 73,601,811 (GRCm39) missense possibly damaging 0.53
R8551:Zfp735 UTSW 11 73,603,122 (GRCm39) missense probably benign 0.06
R8754:Zfp735 UTSW 11 73,603,000 (GRCm39) missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73,581,127 (GRCm39) missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73,601,692 (GRCm39) missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73,602,510 (GRCm39) missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73,602,699 (GRCm39) missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9073:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9193:Zfp735 UTSW 11 73,580,600 (GRCm39) missense possibly damaging 0.71
R9355:Zfp735 UTSW 11 73,602,362 (GRCm39) missense probably benign 0.01
R9414:Zfp735 UTSW 11 73,602,023 (GRCm39) nonsense probably null
R9456:Zfp735 UTSW 11 73,602,403 (GRCm39) missense possibly damaging 0.53
R9573:Zfp735 UTSW 11 73,602,936 (GRCm39) missense possibly damaging 0.67
R9647:Zfp735 UTSW 11 73,580,600 (GRCm39) missense probably damaging 0.98
R9710:Zfp735 UTSW 11 73,601,806 (GRCm39) missense possibly damaging 0.86
Z1176:Zfp735 UTSW 11 73,601,641 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCTAAAACATTTTGGAAAGTTGCGAC -3'
(R):5'- GGTATAATATATTGCATTTCAGACCCC -3'

Sequencing Primer
(F):5'- CATTTTGGAAAGTTGCGACTATAAG -3'
(R):5'- GACCCCCTACTATTCAGGTAAAG -3'
Posted On 2017-06-26