Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Zfp735'

481962

Institutional Source

Beutler Lab

Gene Symbol

Zfp735

Ensembl Gene

ENSMUSG00000060630

Gene Name

zinc finger protein 735

Synonyms

1700012C15Rik

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73688778-73713798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73690348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 70 (D70E)

Ref Sequence

ENSEMBL: ENSMUSP00000079269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080407]

AlphaFold

B1ARH2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080407
AA Change: D70E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: D70E

Domain	Start	End	E-Value	Type
KRAB	8	68	2.2e-34	SMART
ZnF_C2H2	483	505	4.38e1	SMART
ZnF_C2H2	511	533	2.67e-1	SMART
ZnF_C2H2	539	561	1.81e1	SMART
ZnF_C2H2	567	589	1.5e-4	SMART
ZnF_C2H2	595	617	4.87e-4	SMART
ZnF_C2H2	623	645	4.24e-4	SMART
ZnF_C2H2	651	673	2.27e-4	SMART
ZnF_C2H2	679	701	7.49e-5	SMART
ZnF_C2H2	707	729	4.87e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149560

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Zfp735

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Zfp735	APN	11	73711366	missense	possibly damaging	0.86
IGL00798:Zfp735	APN	11	73711560	missense	possibly damaging	0.72
IGL01642:Zfp735	APN	11	73710479	missense	possibly damaging	0.73
IGL01684:Zfp735	APN	11	73690365	missense	possibly damaging	0.86
IGL02096:Zfp735	APN	11	73711428	missense	probably benign	0.01
IGL02238:Zfp735	APN	11	73710493	missense	probably benign	0.00
IGL02505:Zfp735	APN	11	73689800	missense	probably benign	0.03
IGL02740:Zfp735	APN	11	73710586	missense	possibly damaging	0.53
IGL02957:Zfp735	APN	11	73710929	missense	probably benign	0.00
bananaquit	UTSW	11	73710586	nonsense	probably null
bescher	UTSW	11	73712153	missense	possibly damaging	0.93
Galvanic	UTSW	11	73711678	nonsense	probably null
grassquit	UTSW	11	73712203	missense	possibly damaging	0.66
R0114:Zfp735	UTSW	11	73710662	missense	probably benign	0.33
R0217:Zfp735	UTSW	11	73711286	missense	possibly damaging	0.73
R0943:Zfp735	UTSW	11	73712083	missense	probably benign	0.04
R1421:Zfp735	UTSW	11	73710697	missense	probably benign
R1460:Zfp735	UTSW	11	73712333	missense	possibly damaging	0.73
R1493:Zfp735	UTSW	11	73710479	missense	possibly damaging	0.73
R1517:Zfp735	UTSW	11	73710644	missense	probably benign
R1676:Zfp735	UTSW	11	73711475	missense	possibly damaging	0.53
R1709:Zfp735	UTSW	11	73711763	missense	probably benign	0.01
R1871:Zfp735	UTSW	11	73710586	nonsense	probably null
R1931:Zfp735	UTSW	11	73711851	missense	possibly damaging	0.69
R2219:Zfp735	UTSW	11	73711025	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711396	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711397	nonsense	probably null
R3552:Zfp735	UTSW	11	73711241	nonsense	probably null
R3856:Zfp735	UTSW	11	73711456	missense	probably benign	0.01
R3925:Zfp735	UTSW	11	73711124	missense	probably benign	0.33
R4572:Zfp735	UTSW	11	73689785	missense	probably benign	0.02
R4585:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4586:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4619:Zfp735	UTSW	11	73711205	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711855	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711856	missense	probably damaging	0.98
R5435:Zfp735	UTSW	11	73712113	missense	possibly damaging	0.72
R5489:Zfp735	UTSW	11	73710593	nonsense	probably null
R5516:Zfp735	UTSW	11	73710814	missense	probably benign
R5654:Zfp735	UTSW	11	73712138	missense	possibly damaging	0.71
R6332:Zfp735	UTSW	11	73711678	nonsense	probably null
R6427:Zfp735	UTSW	11	73690314	missense	possibly damaging	0.73
R6460:Zfp735	UTSW	11	73711652	missense	probably benign	0.33
R6820:Zfp735	UTSW	11	73688957	start codon destroyed	probably null	0.01
R6831:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6833:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6834:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6897:Zfp735	UTSW	11	73711054	missense	probably benign	0.08
R6941:Zfp735	UTSW	11	73690333	missense	probably benign	0.33
R7335:Zfp735	UTSW	11	73711553	missense	possibly damaging	0.47
R7366:Zfp735	UTSW	11	73712153	missense	possibly damaging	0.93
R7474:Zfp735	UTSW	11	73711176	missense	possibly damaging	0.72
R7487:Zfp735	UTSW	11	73690328	missense	possibly damaging	0.53
R7583:Zfp735	UTSW	11	73711107	missense	possibly damaging	0.86
R7866:Zfp735	UTSW	11	73710803	missense	probably benign	0.00
R8005:Zfp735	UTSW	11	73712314	nonsense	probably null
R8500:Zfp735	UTSW	11	73710985	missense	possibly damaging	0.53
R8551:Zfp735	UTSW	11	73712296	missense	probably benign	0.06
R8754:Zfp735	UTSW	11	73712174	missense	possibly damaging	0.85
R8769:Zfp735	UTSW	11	73690301	missense	possibly damaging	0.53
R8794:Zfp735	UTSW	11	73712203	missense	possibly damaging	0.66
R8835:Zfp735	UTSW	11	73710866	missense	possibly damaging	0.53
R8869:Zfp735	UTSW	11	73711684	missense	possibly damaging	0.53
R8969:Zfp735	UTSW	11	73711873	missense	possibly damaging	0.83
R9072:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9073:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9193:Zfp735	UTSW	11	73689774	missense	possibly damaging	0.71
R9355:Zfp735	UTSW	11	73711536	missense	probably benign	0.01
R9414:Zfp735	UTSW	11	73711197	nonsense	probably null
R9456:Zfp735	UTSW	11	73711577	missense	possibly damaging	0.53
R9573:Zfp735	UTSW	11	73712110	missense	possibly damaging	0.67
R9647:Zfp735	UTSW	11	73689774	missense	probably damaging	0.98
R9710:Zfp735	UTSW	11	73710980	missense	possibly damaging	0.86
Z1176:Zfp735	UTSW	11	73710815	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCTAAAACATTTTGGAAAGTTGCGAC -3'
(R):5'- GGTATAATATATTGCATTTCAGACCCC -3'

Sequencing Primer
(F):5'- CATTTTGGAAAGTTGCGACTATAAG -3'
(R):5'- GACCCCCTACTATTCAGGTAAAG -3'

Posted On

2017-06-26