Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Lrrc37a'

481963

Institutional Source

Beutler Lab

Gene Symbol

Lrrc37a

Ensembl Gene

ENSMUSG00000078632

Gene Name

leucine rich repeat containing 37A

Synonyms

LOC237954

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103451955-103504597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103500958 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1214 (Y1214H)

Ref Sequence

ENSEMBL: ENSMUSP00000121903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153273]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000153273
AA Change: Y1214H

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Y1214H

Domain	Start	End	E-Value	Type
Pfam:LRRC37	199	269	2.6e-15	PFAM
low complexity region	313	329	N/A	INTRINSIC
Pfam:LRRC37	363	432	4e-18	PFAM
low complexity region	457	467	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
Pfam:LRRC37	550	619	2.1e-21	PFAM
Pfam:LRRC37	637	704	2.9e-12	PFAM
Pfam:LRRC37	780	851	2.5e-12	PFAM
Pfam:LRRC37	1078	1148	2.7e-18	PFAM
Pfam:LRRC37	1149	1190	2.1e-7	PFAM
Pfam:LRRC37	1187	1258	2.5e-25	PFAM
Pfam:LRRC37	1255	1300	2.6e-7	PFAM
Pfam:LRRC37	1299	1370	2.4e-27	PFAM
Pfam:LRRC37	1369	1420	2.9e-8	PFAM
Pfam:LRRC37	1419	1488	1.3e-24	PFAM
Pfam:LRRC37	1509	1578	9.2e-21	PFAM
Pfam:LRRC37	1575	1620	1.7e-6	PFAM
Pfam:LRRC37	1619	1686	1.7e-20	PFAM
Pfam:LRRC37	1690	1736	7e-10	PFAM
Pfam:LRRC37	1733	1799	7.5e-17	PFAM
Pfam:LRRC37	1789	1854	5.1e-12	PFAM
Pfam:LRRC37	1850	1921	4.2e-21	PFAM
Pfam:LRRC37	1915	1969	1.1e-9	PFAM
low complexity region	2143	2167	N/A	INTRINSIC
low complexity region	2185	2209	N/A	INTRINSIC
low complexity region	2228	2249	N/A	INTRINSIC
low complexity region	2262	2274	N/A	INTRINSIC
low complexity region	2284	2297	N/A	INTRINSIC
LRR	2419	2438	3.09e1	SMART
LRR	2439	2462	9.96e-1	SMART
LRR	2463	2486	8.24e0	SMART
LRR	2490	2514	3.18e1	SMART
low complexity region	2535	2547	N/A	INTRINSIC
coiled coil region	2712	2735	N/A	INTRINSIC
low complexity region	2861	2871	N/A	INTRINSIC
low complexity region	2937	2950	N/A	INTRINSIC
Pfam:LRRC37AB_C	3063	3209	1.1e-77	PFAM

Meta Mutation Damage Score

0.0715

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Lrrc37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Lrrc37a	APN	11	103500351	missense	probably benign	0.09
IGL01339:Lrrc37a	APN	11	103497937	missense	unknown
IGL01352:Lrrc37a	APN	11	103499355	missense	probably benign	0.39
IGL01382:Lrrc37a	APN	11	103498755	missense	probably damaging	0.99
IGL01395:Lrrc37a	APN	11	103503861	missense	probably benign	0.24
IGL01645:Lrrc37a	APN	11	103504264	missense	probably benign	0.01
IGL01925:Lrrc37a	APN	11	103498419	missense	probably benign	0.01
IGL02006:Lrrc37a	APN	11	103456491	missense	probably damaging	1.00
IGL02127:Lrrc37a	APN	11	103504539	missense	probably benign	0.01
IGL02184:Lrrc37a	APN	11	103497609	missense	unknown
IGL02218:Lrrc37a	APN	11	103500381	missense	probably benign	0.03
IGL02436:Lrrc37a	APN	11	103498177	missense	unknown
IGL02487:Lrrc37a	APN	11	103496037	missense	unknown
IGL02597:Lrrc37a	APN	11	103504287	missense	probably benign	0.01
IGL02634:Lrrc37a	APN	11	103499112	missense	probably benign	0.09
IGL02818:Lrrc37a	APN	11	103501306	missense	possibly damaging	0.47
IGL02829:Lrrc37a	APN	11	103491174	missense	unknown
IGL02987:Lrrc37a	APN	11	103500413	missense	probably benign	0.03
IGL03081:Lrrc37a	APN	11	103456595	missense	unknown
IGL03210:Lrrc37a	APN	11	103499505	missense	probably benign	0.29
IGL03239:Lrrc37a	APN	11	103499407	missense	probably benign	0.03
IGL03285:Lrrc37a	APN	11	103497673	missense	unknown
IGL03296:Lrrc37a	APN	11	103497673	missense	unknown
IGL03299:Lrrc37a	APN	11	103497673	missense	unknown
IGL03370:Lrrc37a	APN	11	103497673	missense	unknown
IGL03390:Lrrc37a	APN	11	103496031	missense	unknown
Lark	UTSW	11	103464354	critical splice donor site	probably null
Longspur	UTSW	11	103502314	missense	probably benign	0.42
F5770:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
P0035:Lrrc37a	UTSW	11	103503132	missense	possibly damaging	0.84
PIT4458001:Lrrc37a	UTSW	11	103504512	missense	probably benign	0.04
R0112:Lrrc37a	UTSW	11	103500913	missense	probably benign	0.19
R0194:Lrrc37a	UTSW	11	103499790	missense	possibly damaging	0.82
R0360:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0364:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0395:Lrrc37a	UTSW	11	103464395	missense	unknown
R0418:Lrrc37a	UTSW	11	103503438	missense	probably benign	0.03
R0505:Lrrc37a	UTSW	11	103503025	missense	probably benign	0.10
R0583:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R1078:Lrrc37a	UTSW	11	103497631	missense	unknown
R1581:Lrrc37a	UTSW	11	103457017	nonsense	probably null
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1907:Lrrc37a	UTSW	11	103457156	missense	unknown
R1982:Lrrc37a	UTSW	11	103498966	missense	probably benign	0.20
R1991:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2017:Lrrc37a	UTSW	11	103501125	missense	probably benign	0.03
R2103:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2110:Lrrc37a	UTSW	11	103497822	missense	unknown
R2190:Lrrc37a	UTSW	11	103500043	missense	possibly damaging	0.82
R2252:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2253:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2894:Lrrc37a	UTSW	11	103497864	missense	unknown
R2899:Lrrc37a	UTSW	11	103497864	missense	unknown
R3439:Lrrc37a	UTSW	11	103497864	missense	unknown
R3899:Lrrc37a	UTSW	11	103497546	missense	unknown
R3916:Lrrc37a	UTSW	11	103455518	missense	possibly damaging	0.83
R3921:Lrrc37a	UTSW	11	103501470	missense	probably benign	0.10
R3977:Lrrc37a	UTSW	11	103457604	missense	unknown
R4043:Lrrc37a	UTSW	11	103498653	missense	possibly damaging	0.95
R4077:Lrrc37a	UTSW	11	103497982	missense	unknown
R4237:Lrrc37a	UTSW	11	103502289	missense	probably damaging	0.97
R4461:Lrrc37a	UTSW	11	103464354	critical splice donor site	probably null
R4498:Lrrc37a	UTSW	11	103501798	missense	probably benign	0.20
R4593:Lrrc37a	UTSW	11	103498969	missense	possibly damaging	0.64
R4670:Lrrc37a	UTSW	11	103504537	missense	probably benign	0.10
R4698:Lrrc37a	UTSW	11	103504104	missense	possibly damaging	0.83
R4750:Lrrc37a	UTSW	11	103455480	missense	probably benign	0.24
R4805:Lrrc37a	UTSW	11	103504309	missense	probably benign	0.01
R4940:Lrrc37a	UTSW	11	103497612	missense	unknown
R4983:Lrrc37a	UTSW	11	103497618	missense	unknown
R4989:Lrrc37a	UTSW	11	103456739	missense	unknown
R5046:Lrrc37a	UTSW	11	103498240	missense	unknown
R5217:Lrrc37a	UTSW	11	103456954	missense	unknown
R5300:Lrrc37a	UTSW	11	103456958	missense	unknown
R5509:Lrrc37a	UTSW	11	103500535	missense	probably benign	0.23
R5550:Lrrc37a	UTSW	11	103498177	missense	unknown
R5655:Lrrc37a	UTSW	11	103498555	missense	probably benign	0.28
R5668:Lrrc37a	UTSW	11	103500175	missense	probably benign	0.03
R5750:Lrrc37a	UTSW	11	103458097	missense	unknown
R5815:Lrrc37a	UTSW	11	103503786	missense	probably benign	0.01
R5976:Lrrc37a	UTSW	11	103499071	missense	possibly damaging	0.73
R6004:Lrrc37a	UTSW	11	103502536	missense	possibly damaging	0.56
R6019:Lrrc37a	UTSW	11	103456596	missense	unknown
R6056:Lrrc37a	UTSW	11	103497658	missense	unknown
R6125:Lrrc37a	UTSW	11	103501560	missense	probably benign	0.19
R6190:Lrrc37a	UTSW	11	103501216	missense	possibly damaging	0.67
R6295:Lrrc37a	UTSW	11	103497633	missense	unknown
R6320:Lrrc37a	UTSW	11	103504051	missense	probably benign	0.10
R6354:Lrrc37a	UTSW	11	103464387	missense	unknown
R6375:Lrrc37a	UTSW	11	103501089	missense	probably benign	0.19
R6406:Lrrc37a	UTSW	11	103497535	missense	unknown
R6468:Lrrc37a	UTSW	11	103460840	missense	unknown
R6490:Lrrc37a	UTSW	11	103456660	missense	unknown
R6502:Lrrc37a	UTSW	11	103492179	missense	unknown
R6509:Lrrc37a	UTSW	11	103504414	missense	probably benign	0.04
R6749:Lrrc37a	UTSW	11	103502097	missense	probably benign	0.29
R6768:Lrrc37a	UTSW	11	103500123	missense	probably benign	0.36
R6912:Lrrc37a	UTSW	11	103457543	missense	unknown
R7081:Lrrc37a	UTSW	11	103457955	missense	unknown
R7083:Lrrc37a	UTSW	11	103503340	missense	probably benign	0.03
R7154:Lrrc37a	UTSW	11	103502856	missense	probably benign	0.03
R7195:Lrrc37a	UTSW	11	103457775	missense	unknown
R7265:Lrrc37a	UTSW	11	103498941	missense	probably benign	0.09
R7276:Lrrc37a	UTSW	11	103456746	missense	unknown
R7362:Lrrc37a	UTSW	11	103457509	missense	unknown
R7450:Lrrc37a	UTSW	11	103498326	missense	probably benign	0.01
R7458:Lrrc37a	UTSW	11	103497432	missense	unknown
R7487:Lrrc37a	UTSW	11	103498219	missense	unknown
R7535:Lrrc37a	UTSW	11	103501857	missense	possibly damaging	0.68
R7593:Lrrc37a	UTSW	11	103500952	missense	probably benign	0.03
R7677:Lrrc37a	UTSW	11	103499638	missense	probably benign	0.26
R7686:Lrrc37a	UTSW	11	103498236	missense	unknown
R7694:Lrrc37a	UTSW	11	103504378	missense	probably benign	0.12
R7696:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R7717:Lrrc37a	UTSW	11	103504300	missense	probably benign	0.01
R7736:Lrrc37a	UTSW	11	103497459	missense	unknown
R7841:Lrrc37a	UTSW	11	103501105	missense	probably benign	0.03
R7885:Lrrc37a	UTSW	11	103503042	missense	probably benign	0.01
R7888:Lrrc37a	UTSW	11	103501481	missense	probably benign	0.19
R7993:Lrrc37a	UTSW	11	103457961	missense	unknown
R8051:Lrrc37a	UTSW	11	103503126	missense	possibly damaging	0.48
R8082:Lrrc37a	UTSW	11	103457422	missense	unknown
R8097:Lrrc37a	UTSW	11	103504099	missense	probably benign	0.04
R8108:Lrrc37a	UTSW	11	103503057	missense	probably benign	0.24
R8269:Lrrc37a	UTSW	11	103497898	missense	unknown
R8311:Lrrc37a	UTSW	11	103503421	missense	probably benign	0.05
R8403:Lrrc37a	UTSW	11	103501585	missense	probably benign	0.10
R8408:Lrrc37a	UTSW	11	103460809	missense	unknown
R8529:Lrrc37a	UTSW	11	103457547	missense	unknown
R8711:Lrrc37a	UTSW	11	103497524	nonsense	probably null
R8757:Lrrc37a	UTSW	11	103457940	missense	unknown
R8759:Lrrc37a	UTSW	11	103457940	missense	unknown
R8769:Lrrc37a	UTSW	11	103498710	missense	probably benign	0.10
R8785:Lrrc37a	UTSW	11	103456416	missense	probably damaging	1.00
R8837:Lrrc37a	UTSW	11	103503969	missense	probably benign	0.43
R8850:Lrrc37a	UTSW	11	103502655	missense
R8871:Lrrc37a	UTSW	11	103456549	missense	unknown
R8894:Lrrc37a	UTSW	11	103456623	missense	unknown
R8971:Lrrc37a	UTSW	11	103500664	missense	probably benign	0.19
R8979:Lrrc37a	UTSW	11	103503007	missense	possibly damaging	0.48
R9012:Lrrc37a	UTSW	11	103499152	missense	probably benign	0.05
R9047:Lrrc37a	UTSW	11	103500549	missense	probably damaging	0.97
R9167:Lrrc37a	UTSW	11	103456832	missense	unknown
R9171:Lrrc37a	UTSW	11	103502314	missense	probably benign	0.42
R9194:Lrrc37a	UTSW	11	103500850	missense	probably benign	0.03
R9258:Lrrc37a	UTSW	11	103502196	missense	probably benign	0.20
R9282:Lrrc37a	UTSW	11	103500807	missense	probably benign	0.03
R9294:Lrrc37a	UTSW	11	103504533	missense	probably benign	0.10
R9349:Lrrc37a	UTSW	11	103497628	missense	unknown
R9560:Lrrc37a	UTSW	11	103456594	missense	unknown
R9595:Lrrc37a	UTSW	11	103501726	missense	probably benign	0.01
R9628:Lrrc37a	UTSW	11	103503504	missense	probably benign	0.03
V7580:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
X0018:Lrrc37a	UTSW	11	103499544	missense	possibly damaging	0.78
Z1176:Lrrc37a	UTSW	11	103456486	missense	probably damaging	1.00
Z1176:Lrrc37a	UTSW	11	103499034	missense	possibly damaging	0.68
Z1176:Lrrc37a	UTSW	11	103501094	missense	probably benign	0.09
Z1177:Lrrc37a	UTSW	11	103499967	missense	possibly damaging	0.46
Z1177:Lrrc37a	UTSW	11	103500520	missense	probably benign	0.43
Z1177:Lrrc37a	UTSW	11	103500598	missense	probably benign	0.20
Z1177:Lrrc37a	UTSW	11	103503027	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TGCTCTGGCGAAGGAACTATAG -3'
(R):5'- CTTCACAGTATACTCCAGAGGCC -3'

Sequencing Primer
(F):5'- CTCTGGCGAAGGAACTATAGTCTTC -3'
(R):5'- GTATACTCCAGAGGCCAACCAC -3'

Posted On

2017-06-26