Incidental Mutation 'R5990:Lrrc37a'
ID 481963
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103391784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1214 (Y1214H)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: Y1214H

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Y1214H

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103,390,616 (GRCm39) missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1982:Lrrc37a UTSW 11 103,389,792 (GRCm39) missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103,395,126 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9047:Lrrc37a UTSW 11 103,391,375 (GRCm39) missense probably damaging 0.97
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9194:Lrrc37a UTSW 11 103,391,676 (GRCm39) missense probably benign 0.03
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGCTCTGGCGAAGGAACTATAG -3'
(R):5'- CTTCACAGTATACTCCAGAGGCC -3'

Sequencing Primer
(F):5'- CTCTGGCGAAGGAACTATAGTCTTC -3'
(R):5'- GTATACTCCAGAGGCCAACCAC -3'
Posted On 2017-06-26