Incidental Mutation 'R5990:Wdr35'
ID481965
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9016511 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 724 (D724G)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
Predicted Effect probably damaging
Transcript: ENSMUST00000085745
AA Change: D724G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: D724G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111113
AA Change: D713G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: D713G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Meta Mutation Damage Score 0.4138 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Atp8b3 G A 10: 80,525,697 T797M possibly damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc16 G A 9: 18,659,243 A660V unknown Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Patl2 T C 2: 122,124,484 D361G probably damaging Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Prdm2 T C 4: 143,170,113 N102D probably damaging Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Ttll2 C A 17: 7,352,367 G54W possibly damaging Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCAGTCCTCAGTATAAGCATG -3'
(R):5'- TATGAACTGACATCACTTGGGG -3'

Sequencing Primer
(F):5'- GTCCTCAGTATAAGCATGTTACATG -3'
(R):5'- CCTGCCAAAGTAGGCAATA -3'
Posted On2017-06-26