Incidental Mutation 'R0515:Nfe2'
ID48197
Institutional Source Beutler Lab
Gene Symbol Nfe2
Ensembl Gene ENSMUSG00000058794
Gene Namenuclear factor, erythroid derived 2
Synonymsp45nf-e2, p45NFE2, p45, NF-E2
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location103248212-103258403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103249427 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000116079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036004] [ENSMUST00000075192] [ENSMUST00000087351] [ENSMUST00000131364] [ENSMUST00000132438] [ENSMUST00000132836] [ENSMUST00000133600] [ENSMUST00000134193] [ENSMUST00000134554] [ENSMUST00000149111] [ENSMUST00000154510] [ENSMUST00000156927] [ENSMUST00000230171] [ENSMUST00000230489] [ENSMUST00000231141]
Predicted Effect probably benign
Transcript: ENSMUST00000036004
SMART Domains Protein: ENSMUSP00000042658
Gene: ENSMUSG00000046434

DomainStartEndE-ValueType
RRM 15 87 6.44e-27 SMART
RRM 106 178 6.86e-22 SMART
low complexity region 190 321 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075192
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074684
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087351
SMART Domains Protein: ENSMUSP00000084609
Gene: ENSMUSG00000046434

DomainStartEndE-ValueType
RRM 15 87 6.44e-27 SMART
RRM 106 178 6.86e-22 SMART
Pfam:HnRNPA1 257 292 4e-18 PFAM
low complexity region 303 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131364
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116158
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132438
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116079
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132836
AA Change: T46S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120256
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133600
AA Change: T69S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121817
Gene: ENSMUSG00000058794
AA Change: T69S

DomainStartEndE-ValueType
low complexity region 76 91 N/A INTRINSIC
BRLZ 287 351 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134193
AA Change: T46S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123064
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134554
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117474
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149111
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122476
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154510
AA Change: T46S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116678
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156927
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114160
Gene: ENSMUSG00000058794
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230171
Predicted Effect probably benign
Transcript: ENSMUST00000230489
Predicted Effect probably benign
Transcript: ENSMUST00000231141
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack platelets and most die as neonates from internal bleeding. Survivors exhibit hypochromia, reticulocytosis, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Nfe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Nfe2 APN 15 103249180 missense probably damaging 1.00
nevio UTSW 15 103248805 missense probably damaging 1.00
R0880:Nfe2 UTSW 15 103249262 missense probably damaging 1.00
R1613:Nfe2 UTSW 15 103249129 missense probably damaging 1.00
R4049:Nfe2 UTSW 15 103250937 missense possibly damaging 0.93
R4594:Nfe2 UTSW 15 103248805 missense probably damaging 1.00
R5523:Nfe2 UTSW 15 103249129 missense probably damaging 1.00
R6263:Nfe2 UTSW 15 103250951 missense probably damaging 0.96
Z1177:Nfe2 UTSW 15 103248557 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGCTTTGACACTGGTATGGCTACATTA -3'
(R):5'- CCAGTTCAATGTGAGGTTGTCTTCTGA -3'

Sequencing Primer
(F):5'- CTGGTATGGCTACATTACCATAGGAG -3'
(R):5'- atccacctgcctctgcc -3'
Posted On2013-06-12