Mutagenetix > Incidental Mutation

Incidental Mutation 'R5990:Ints9'

481973

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

044170-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65039328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 648 (L648Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

AlphaFold

Q8K114

Predicted Effect

probably damaging
Transcript: ENSMUST00000043914
AA Change: L648Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: L648Q

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225790

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Trio	A	G	15: 27,891,459	V402A	probably benign	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R0582:Ints9	UTSW	14	64980149	missense	probably damaging	1.00
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4133:Ints9	UTSW	14	64990554	missense	probably benign
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5261:Ints9	UTSW	14	65008072	missense	probably benign	0.25
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R6009:Ints9	UTSW	14	65008082	missense	probably benign	0.43
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
R8183:Ints9	UTSW	14	65036453	missense	probably damaging	0.98
R8223:Ints9	UTSW	14	65020360	missense	possibly damaging	0.94
R8282:Ints9	UTSW	14	65007308	missense	probably benign	0.00
R8314:Ints9	UTSW	14	65029030	missense	probably damaging	1.00
R8341:Ints9	UTSW	14	65036414	missense	probably benign	0.14
R8548:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9356:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9434:Ints9	UTSW	14	65008057	missense	probably benign	0.00
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTCTTGGTTGGACTCTGG -3'
(R):5'- AGTACGAGGAAGTCACACTGGC -3'

Sequencing Primer
(F):5'- TCTGGCCCCGATGTCAGAG -3'
(R):5'- TCCTCTCCGGAAGTCATAGGAC -3'

Posted On

2017-06-26