Incidental Mutation 'R5990:Ints9'
ID 481973
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65187494-65277284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65276777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 648 (L648Q)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably damaging
Transcript: ENSMUST00000043914
AA Change: L648Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: L648Q

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225790
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65,274,870 (GRCm39) missense probably benign 0.00
IGL02374:Ints9 APN 14 65,276,782 (GRCm39) missense probably benign 0.00
IGL02728:Ints9 APN 14 65,230,457 (GRCm39) missense probably damaging 1.00
IGL02992:Ints9 APN 14 65,217,613 (GRCm39) missense probably benign 0.08
IGL03151:Ints9 APN 14 65,269,789 (GRCm39) missense possibly damaging 0.86
R0437:Ints9 UTSW 14 65,223,818 (GRCm39) splice site probably benign
R0582:Ints9 UTSW 14 65,217,598 (GRCm39) missense probably damaging 1.00
R1525:Ints9 UTSW 14 65,232,460 (GRCm39) missense probably benign 0.05
R1569:Ints9 UTSW 14 65,217,571 (GRCm39) missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65,269,705 (GRCm39) missense probably damaging 1.00
R1839:Ints9 UTSW 14 65,253,979 (GRCm39) missense probably damaging 1.00
R1862:Ints9 UTSW 14 65,263,862 (GRCm39) missense probably benign
R1892:Ints9 UTSW 14 65,257,872 (GRCm39) missense probably benign 0.08
R2146:Ints9 UTSW 14 65,223,792 (GRCm39) missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65,245,446 (GRCm39) missense possibly damaging 0.61
R3015:Ints9 UTSW 14 65,187,727 (GRCm39) missense probably benign 0.00
R4133:Ints9 UTSW 14 65,228,003 (GRCm39) missense probably benign
R4180:Ints9 UTSW 14 65,230,430 (GRCm39) missense probably damaging 1.00
R4509:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65,269,729 (GRCm39) missense possibly damaging 0.82
R5023:Ints9 UTSW 14 65,217,677 (GRCm39) missense probably damaging 1.00
R5117:Ints9 UTSW 14 65,230,540 (GRCm39) nonsense probably null
R5261:Ints9 UTSW 14 65,245,521 (GRCm39) missense probably benign 0.25
R5582:Ints9 UTSW 14 65,266,345 (GRCm39) missense possibly damaging 0.83
R6009:Ints9 UTSW 14 65,245,531 (GRCm39) missense probably benign 0.43
R6241:Ints9 UTSW 14 65,217,659 (GRCm39) missense possibly damaging 0.90
R6351:Ints9 UTSW 14 65,230,456 (GRCm39) missense probably damaging 0.98
R6821:Ints9 UTSW 14 65,274,907 (GRCm39) missense probably benign 0.20
R7422:Ints9 UTSW 14 65,269,747 (GRCm39) missense possibly damaging 0.93
R7442:Ints9 UTSW 14 65,232,513 (GRCm39) nonsense probably null
R7475:Ints9 UTSW 14 65,263,914 (GRCm39) missense probably null 0.23
R8183:Ints9 UTSW 14 65,273,902 (GRCm39) missense probably damaging 0.98
R8223:Ints9 UTSW 14 65,257,809 (GRCm39) missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65,244,757 (GRCm39) missense probably benign 0.00
R8314:Ints9 UTSW 14 65,266,479 (GRCm39) missense probably damaging 1.00
R8341:Ints9 UTSW 14 65,273,863 (GRCm39) missense probably benign 0.14
R8548:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9356:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9434:Ints9 UTSW 14 65,245,506 (GRCm39) missense probably benign 0.00
Z1176:Ints9 UTSW 14 65,274,903 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTCTTGGTTGGACTCTGG -3'
(R):5'- AGTACGAGGAAGTCACACTGGC -3'

Sequencing Primer
(F):5'- TCTGGCCCCGATGTCAGAG -3'
(R):5'- TCCTCTCCGGAAGTCATAGGAC -3'
Posted On 2017-06-26