Incidental Mutation 'R5990:Rhobtb2'
ID 481974
Institutional Source Beutler Lab
Gene Symbol Rhobtb2
Ensembl Gene ENSMUSG00000022075
Gene Name Rho-related BTB domain containing 2
Synonyms E130206H14Rik, Dbc2
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70022439-70043085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70033818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 469 (N469S)
Ref Sequence ENSEMBL: ENSMUSP00000022665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022665]
AlphaFold Q91V93
Predicted Effect probably damaging
Transcript: ENSMUST00000022665
AA Change: N469S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075
AA Change: N469S

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225088
Meta Mutation Damage Score 0.1628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small Rho GTPase and a candidate tumor suppressor. The encoded protein interacts with the cullin-3 protein, a ubiquitin E3 ligase necessary for mitotic cell division. This protein inhibits the growth and spread of some types of breast cancer. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Rhobtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Rhobtb2 APN 14 70,034,037 (GRCm39) missense possibly damaging 0.82
IGL02437:Rhobtb2 APN 14 70,033,365 (GRCm39) missense probably damaging 1.00
dichotomy UTSW 14 70,038,104 (GRCm39) missense probably damaging 1.00
gutsy UTSW 14 70,038,080 (GRCm39) missense probably damaging 1.00
Paunchy UTSW 14 70,035,627 (GRCm39) missense probably damaging 1.00
reeses UTSW 14 70,037,160 (GRCm39) missense probably damaging 1.00
smoke UTSW 14 70,033,893 (GRCm39) missense probably damaging 0.99
waft UTSW 14 70,034,184 (GRCm39) missense probably benign 0.22
R0034:Rhobtb2 UTSW 14 70,026,137 (GRCm39) missense probably benign
R0149:Rhobtb2 UTSW 14 70,033,357 (GRCm39) missense probably benign 0.02
R0361:Rhobtb2 UTSW 14 70,033,357 (GRCm39) missense probably benign 0.02
R0376:Rhobtb2 UTSW 14 70,034,184 (GRCm39) missense probably benign 0.22
R0594:Rhobtb2 UTSW 14 70,031,397 (GRCm39) missense probably benign
R1005:Rhobtb2 UTSW 14 70,035,726 (GRCm39) missense probably damaging 1.00
R1072:Rhobtb2 UTSW 14 70,024,976 (GRCm39) small deletion probably benign
R1929:Rhobtb2 UTSW 14 70,033,893 (GRCm39) missense probably damaging 0.99
R1938:Rhobtb2 UTSW 14 70,034,062 (GRCm39) missense probably benign 0.01
R2058:Rhobtb2 UTSW 14 70,031,488 (GRCm39) missense possibly damaging 0.49
R2244:Rhobtb2 UTSW 14 70,024,976 (GRCm39) small deletion probably benign
R2992:Rhobtb2 UTSW 14 70,035,772 (GRCm39) missense probably damaging 1.00
R3953:Rhobtb2 UTSW 14 70,031,488 (GRCm39) missense possibly damaging 0.49
R4655:Rhobtb2 UTSW 14 70,033,438 (GRCm39) missense probably damaging 0.97
R4712:Rhobtb2 UTSW 14 70,037,160 (GRCm39) missense probably damaging 1.00
R4744:Rhobtb2 UTSW 14 70,031,451 (GRCm39) missense probably damaging 1.00
R4771:Rhobtb2 UTSW 14 70,034,499 (GRCm39) missense probably benign 0.20
R5648:Rhobtb2 UTSW 14 70,034,593 (GRCm39) missense probably damaging 1.00
R6166:Rhobtb2 UTSW 14 70,035,627 (GRCm39) missense probably damaging 1.00
R6186:Rhobtb2 UTSW 14 70,035,693 (GRCm39) missense probably damaging 1.00
R7448:Rhobtb2 UTSW 14 70,033,397 (GRCm39) nonsense probably null
R7591:Rhobtb2 UTSW 14 70,037,190 (GRCm39) missense possibly damaging 0.61
R7626:Rhobtb2 UTSW 14 70,034,386 (GRCm39) missense probably damaging 1.00
R7793:Rhobtb2 UTSW 14 70,034,280 (GRCm39) missense probably benign 0.01
R7898:Rhobtb2 UTSW 14 70,033,746 (GRCm39) missense probably damaging 1.00
R8026:Rhobtb2 UTSW 14 70,034,214 (GRCm39) missense probably benign 0.41
R8109:Rhobtb2 UTSW 14 70,038,080 (GRCm39) missense probably damaging 1.00
R8182:Rhobtb2 UTSW 14 70,034,070 (GRCm39) missense probably benign
R8687:Rhobtb2 UTSW 14 70,038,104 (GRCm39) missense probably damaging 1.00
R8704:Rhobtb2 UTSW 14 70,031,373 (GRCm39) missense probably damaging 1.00
R9166:Rhobtb2 UTSW 14 70,034,703 (GRCm39) missense probably damaging 1.00
R9303:Rhobtb2 UTSW 14 70,025,376 (GRCm39) missense probably damaging 1.00
R9304:Rhobtb2 UTSW 14 70,025,376 (GRCm39) missense probably damaging 1.00
R9627:Rhobtb2 UTSW 14 70,034,349 (GRCm39) missense probably damaging 1.00
R9686:Rhobtb2 UTSW 14 70,034,005 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGAGAGCAGGACAGCCATATC -3'
(R):5'- TGACCTTCAAATCCCGGCTG -3'

Sequencing Primer
(F):5'- GAGCAGGACAGCCATATCTTCATG -3'
(R):5'- CTTCAAATCCCGGCTGATGGTG -3'
Posted On 2017-06-26