Mutagenetix > Incidental Mutations

Incidental Mutation 'R5990:Trio'

481976

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

044170-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27891459 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 402 (V402A)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]

Predicted Effect

unknown
Transcript: ENSMUST00000090247
AA Change: V461A

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: V461A

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227337
AA Change: V402A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1549

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	T	10: 76,449,289	M11L	probably benign	Het
Acad10	A	G	5: 121,645,405	L319P	probably damaging	Het
Adam12	C	A	7: 133,931,736	C471F	probably damaging	Het
Arfgef1	A	G	1: 10,172,921	Y1065H	probably damaging	Het
Atp8b3	G	A	10: 80,525,697	T797M	possibly damaging	Het
Auts2	G	A	5: 131,476,895		probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Ccdc146	A	G	5: 21,318,182	S286P	probably benign	Het
Chsy3	GT	G	18: 59,176,166		probably null	Het
Cmtr1	T	C	17: 29,702,161	Y794H	probably benign	Het
Copb2	A	G	9: 98,570,325	E54G	probably damaging	Het
Ctsk	A	T	3: 95,501,456	H77L	probably damaging	Het
Dnah3	T	C	7: 120,073,541	Y546C	probably benign	Het
Ephb2	A	T	4: 136,696,055	V304E	probably benign	Het
Ern1	C	T	11: 106,411,769	V420I	probably benign	Het
Esrrg	A	T	1: 188,198,798	E339V	probably damaging	Het
Fbxo10	A	C	4: 45,061,960	F189V	probably damaging	Het
Foxl1	G	T	8: 121,128,421	A154S	probably damaging	Het
Frs3	A	G	17: 47,701,677	D103G	possibly damaging	Het
Gdpd4	A	G	7: 98,040,930	T610A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm4847	C	T	1: 166,643,373	S36N	probably benign	Het
Grm8	G	T	6: 27,363,624	L631I	probably damaging	Het
Ints9	T	A	14: 65,039,328	L648Q	probably damaging	Het
Kansl1l	T	C	1: 66,735,726	H647R	probably damaging	Het
Kcnq1	T	A	7: 143,261,368	H501Q	probably damaging	Het
Kctd20	T	C	17: 28,966,910	L409P	probably benign	Het
Kiss1r	A	G	10: 79,918,707	T12A	probably benign	Het
Kndc1	T	A	7: 139,927,420	V1173E	probably damaging	Het
Kprp	T	C	3: 92,824,774	E323G	probably damaging	Het
Krtap10-4	A	T	10: 77,826,607		probably benign	Het
Lrrc37a	A	G	11: 103,500,958	Y1214H	probably benign	Het
Lysmd3	G	A	13: 81,669,588	G228D	probably damaging	Het
Muc16	G	A	9: 18,659,243	A660V	unknown	Het
Muc5b	T	C	7: 141,858,161	C1615R	unknown	Het
Nans	A	T	4: 46,489,441	N28I	probably damaging	Het
Nlrp4b	C	T	7: 10,714,491	S207L	possibly damaging	Het
Nrd1	T	G	4: 109,019,071	F355V	probably damaging	Het
Nrip2	C	T	6: 128,400,016		probably benign	Het
Nufip1	C	T	14: 76,114,188	P161L	probably damaging	Het
Ogdhl	C	T	14: 32,327,114	H114Y	possibly damaging	Het
Olfr1295	T	A	2: 111,564,674	I257F	probably damaging	Het
Olfr160	G	T	9: 37,712,110	H56Q	probably damaging	Het
Opa1	T	A	16: 29,587,018	W134R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Patl2	T	C	2: 122,124,484	D361G	probably damaging	Het
Pcx	A	G	19: 4,621,266	D1172G	probably damaging	Het
Phax	A	G	18: 56,575,603	T58A	probably benign	Het
Phf11b	T	A	14: 59,324,926	I177L	possibly damaging	Het
Pole	T	A	5: 110,302,144	V819D	probably damaging	Het
Poll	T	C	19: 45,553,155	D458G	possibly damaging	Het
Polr2m	G	A	9: 71,479,320		probably null	Het
Ppp1r9a	C	A	6: 5,134,660	H928N	probably benign	Het
Prdm2	T	C	4: 143,170,113	N102D	probably damaging	Het
Rbm45	A	T	2: 76,370,412	D95V	probably benign	Het
Rdh19	A	G	10: 127,859,594	M226V	probably benign	Het
Rev3l	T	G	10: 39,823,811	S1435A	probably benign	Het
Rgs20	A	G	1: 4,912,330	I305T	probably benign	Het
Rhobtb2	T	C	14: 69,796,369	N469S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rps6ka1	A	G	4: 133,866,397	I177T	probably damaging	Het
Samd12	T	A	15: 53,719,623	D105V	probably damaging	Het
Setd3	A	T	12: 108,160,335	D88E	probably benign	Het
Sfmbt2	G	T	2: 10,579,381	V850L	possibly damaging	Het
Slc26a10	C	A	10: 127,178,758	A195S	possibly damaging	Het
Smcp	C	A	3: 92,584,250	A97S	unknown	Het
Stxbp5	G	A	10: 9,835,933	H248Y	probably damaging	Het
Syne2	T	C	12: 76,024,144	L4457P	probably benign	Het
Tbx3	A	G	5: 119,680,529	T390A	probably benign	Het
Tmeff2	G	A	1: 50,979,442	W194*	probably null	Het
Tmem120b	G	A	5: 123,104,481	R174Q	probably damaging	Het
Ttll2	C	A	17: 7,352,367	G54W	possibly damaging	Het
Uba7	G	A	9: 107,981,234	V786M	probably damaging	Het
Vmn2r32	T	C	7: 7,479,810	E55G	probably damaging	Het
Wdr35	A	G	12: 9,016,511	D724G	probably damaging	Het
Xrcc1	G	A	7: 24,567,868	V381M	probably damaging	Het
Zdhhc11	T	A	13: 73,979,184	W227R	probably benign	Het
Zfp341	T	C	2: 154,645,659	S681P	probably damaging	Het
Zfp735	T	A	11: 73,690,348	D70E	possibly damaging	Het
Zmat4	G	A	8: 23,929,263	A104T	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCTGGAAGGAATGCCTAAG -3'
(R):5'- CACATCCCAGTGAGGAATCAGAG -3'

Sequencing Primer
(F):5'- GGAATGCCTAAGCTCCAGC -3'
(R):5'- GAATCAGAGCAGCCTTTTGC -3'

Posted On

2017-06-26