Incidental Mutation 'R5990:Opa1'
ID 481978
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene Name OPA1, mitochondrial dynamin like GTPase
Synonyms optic atrophy 1, lilr3, 1200011N24Rik
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 29398152-29473702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29405836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 134 (W134R)
Ref Sequence ENSEMBL: ENSMUSP00000124739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
AlphaFold P58281
Predicted Effect possibly damaging
Transcript: ENSMUST00000038867
AA Change: W134R

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: W134R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably damaging
Transcript: ENSMUST00000160475
AA Change: W134R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084
AA Change: W134R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000160597
AA Change: W134R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: W134R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161186
AA Change: W134R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: W134R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162240
AA Change: W2R
SMART Domains Protein: ENSMUSP00000124029
Gene: ENSMUSG00000038084
AA Change: W2R

DomainStartEndE-ValueType
low complexity region 58 74 N/A INTRINSIC
coiled coil region 93 176 N/A INTRINSIC
Pfam:Dynamin_N 215 296 5.7e-18 PFAM
Meta Mutation Damage Score 0.8361 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29,436,933 (GRCm39) splice site probably benign
IGL01087:Opa1 APN 16 29,405,815 (GRCm39) missense probably damaging 1.00
IGL01799:Opa1 APN 16 29,435,476 (GRCm39) missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29,405,813 (GRCm39) missense probably benign 0.35
IGL02067:Opa1 APN 16 29,435,473 (GRCm39) missense probably damaging 1.00
IGL02317:Opa1 APN 16 29,433,984 (GRCm39) critical splice donor site probably null
IGL02567:Opa1 APN 16 29,407,104 (GRCm39) missense probably benign 0.01
IGL02826:Opa1 APN 16 29,429,705 (GRCm39) missense probably null
Longshanks UTSW 16 29,437,077 (GRCm39) missense probably damaging 1.00
R0032:Opa1 UTSW 16 29,433,887 (GRCm39) missense probably damaging 1.00
R0032:Opa1 UTSW 16 29,433,887 (GRCm39) missense probably damaging 1.00
R0092:Opa1 UTSW 16 29,444,412 (GRCm39) missense probably damaging 0.99
R0114:Opa1 UTSW 16 29,448,453 (GRCm39) missense probably benign 0.35
R0200:Opa1 UTSW 16 29,432,947 (GRCm39) missense probably benign 0.08
R0308:Opa1 UTSW 16 29,440,349 (GRCm39) missense probably damaging 0.98
R0427:Opa1 UTSW 16 29,430,279 (GRCm39) missense probably damaging 0.98
R0671:Opa1 UTSW 16 29,421,025 (GRCm39) splice site probably benign
R1768:Opa1 UTSW 16 29,439,628 (GRCm39) missense probably benign
R1889:Opa1 UTSW 16 29,444,403 (GRCm39) missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29,429,698 (GRCm39) missense probably damaging 1.00
R3933:Opa1 UTSW 16 29,429,698 (GRCm39) missense probably damaging 1.00
R4434:Opa1 UTSW 16 29,430,801 (GRCm39) missense probably damaging 1.00
R4618:Opa1 UTSW 16 29,405,857 (GRCm39) missense probably damaging 1.00
R4926:Opa1 UTSW 16 29,467,791 (GRCm39) missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29,416,438 (GRCm39) missense probably damaging 0.99
R5249:Opa1 UTSW 16 29,437,077 (GRCm39) missense probably damaging 1.00
R5266:Opa1 UTSW 16 29,436,948 (GRCm39) missense probably benign 0.19
R5275:Opa1 UTSW 16 29,430,397 (GRCm39) missense probably damaging 1.00
R5372:Opa1 UTSW 16 29,404,937 (GRCm39) missense probably benign 0.00
R6054:Opa1 UTSW 16 29,433,952 (GRCm39) missense probably damaging 1.00
R6483:Opa1 UTSW 16 29,447,525 (GRCm39) missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29,444,332 (GRCm39) missense probably benign 0.06
R6889:Opa1 UTSW 16 29,439,686 (GRCm39) missense probably benign 0.22
R7225:Opa1 UTSW 16 29,432,857 (GRCm39) splice site probably null
R7243:Opa1 UTSW 16 29,405,814 (GRCm39) missense probably benign 0.01
R7324:Opa1 UTSW 16 29,405,799 (GRCm39) missense probably benign
R7831:Opa1 UTSW 16 29,467,755 (GRCm39) missense probably benign 0.02
R8304:Opa1 UTSW 16 29,416,489 (GRCm39) missense possibly damaging 0.80
R8317:Opa1 UTSW 16 29,432,962 (GRCm39) missense probably damaging 1.00
R8353:Opa1 UTSW 16 29,439,686 (GRCm39) missense probably damaging 0.99
R8453:Opa1 UTSW 16 29,439,686 (GRCm39) missense probably damaging 0.99
R8795:Opa1 UTSW 16 29,448,450 (GRCm39) missense probably damaging 1.00
R8919:Opa1 UTSW 16 29,424,340 (GRCm39) missense probably damaging 1.00
R9053:Opa1 UTSW 16 29,404,836 (GRCm39) nonsense probably null
R9087:Opa1 UTSW 16 29,437,053 (GRCm39) missense probably damaging 1.00
R9172:Opa1 UTSW 16 29,439,232 (GRCm39) missense probably benign 0.01
R9355:Opa1 UTSW 16 29,432,807 (GRCm39) missense probably damaging 1.00
R9434:Opa1 UTSW 16 29,404,874 (GRCm39) missense probably benign 0.01
R9511:Opa1 UTSW 16 29,429,738 (GRCm39) missense probably damaging 1.00
R9612:Opa1 UTSW 16 29,430,255 (GRCm39) missense
R9784:Opa1 UTSW 16 29,437,029 (GRCm39) nonsense probably null
RF012:Opa1 UTSW 16 29,432,784 (GRCm39) missense probably damaging 1.00
T0722:Opa1 UTSW 16 29,429,748 (GRCm39) critical splice donor site probably null
X0065:Opa1 UTSW 16 29,439,602 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCTGATTAAAGACCTGCACTTACC -3'
(R):5'- TGCATCCTAGTATGATACACACCC -3'

Sequencing Primer
(F):5'- AGACCTGCACTTACCTAAATTTGTTC -3'
(R):5'- TAGTATGATACACACCCACGCAC -3'
Posted On 2017-06-26