Incidental Mutation 'R5990:Parp14'
ID 481979
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Name poly (ADP-ribose) polymerase family, member 14
Synonyms CoaSt6, collaborator of Stat6, 1600029O10Rik
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.493) question?
Stock # R5990 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 35653244-35691914 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35661827 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1403 (P1403S)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
AlphaFold Q2EMV9
PDB Structure Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: P1403S

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: P1403S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35,661,445 (GRCm39) missense probably benign 0.00
IGL00497:Parp14 APN 16 35,655,206 (GRCm39) missense probably damaging 1.00
IGL00754:Parp14 APN 16 35,659,741 (GRCm39) missense probably benign 0.15
IGL00960:Parp14 APN 16 35,661,589 (GRCm39) missense probably benign 0.20
IGL01321:Parp14 APN 16 35,676,929 (GRCm39) missense probably benign
IGL01397:Parp14 APN 16 35,679,098 (GRCm39) missense probably benign 0.19
IGL01591:Parp14 APN 16 35,678,877 (GRCm39) missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35,677,805 (GRCm39) missense probably damaging 1.00
IGL01734:Parp14 APN 16 35,678,970 (GRCm39) missense probably benign 0.00
IGL02156:Parp14 APN 16 35,678,967 (GRCm39) missense probably benign 0.13
IGL02951:Parp14 APN 16 35,678,903 (GRCm39) missense probably benign 0.06
IGL03067:Parp14 APN 16 35,676,878 (GRCm39) missense probably benign 0.10
IGL03135:Parp14 APN 16 35,678,381 (GRCm39) missense probably damaging 1.00
IGL03141:Parp14 APN 16 35,659,663 (GRCm39) missense probably benign 0.00
IGL03146:Parp14 APN 16 35,678,823 (GRCm39) nonsense probably null
IGL03333:Parp14 APN 16 35,661,800 (GRCm39) missense probably benign 0.08
IGL03391:Parp14 APN 16 35,678,640 (GRCm39) missense probably benign
thurston UTSW 16 35,664,785 (GRCm39) splice site probably benign
PIT4585001:Parp14 UTSW 16 35,678,975 (GRCm39) missense probably benign 0.03
R0306:Parp14 UTSW 16 35,676,944 (GRCm39) missense probably benign
R0506:Parp14 UTSW 16 35,661,779 (GRCm39) missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35,661,382 (GRCm39) missense probably benign 0.00
R0606:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R0612:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R0699:Parp14 UTSW 16 35,680,955 (GRCm39) missense probably damaging 1.00
R0786:Parp14 UTSW 16 35,661,172 (GRCm39) missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35,678,888 (GRCm39) missense probably benign 0.03
R0900:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1087:Parp14 UTSW 16 35,678,658 (GRCm39) missense probably damaging 1.00
R1104:Parp14 UTSW 16 35,664,785 (GRCm39) splice site probably benign
R1120:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1134:Parp14 UTSW 16 35,655,272 (GRCm39) missense probably damaging 1.00
R1153:Parp14 UTSW 16 35,678,041 (GRCm39) missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1160:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1237:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1238:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1239:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1423:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1511:Parp14 UTSW 16 35,677,594 (GRCm39) missense probably benign 0.00
R1518:Parp14 UTSW 16 35,677,008 (GRCm39) missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1707:Parp14 UTSW 16 35,678,219 (GRCm39) missense probably damaging 1.00
R1792:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1831:Parp14 UTSW 16 35,678,958 (GRCm39) missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35,683,819 (GRCm39) missense probably damaging 1.00
R1889:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1902:Parp14 UTSW 16 35,673,888 (GRCm39) critical splice donor site probably null
R1943:Parp14 UTSW 16 35,656,499 (GRCm39) missense probably damaging 1.00
R1954:Parp14 UTSW 16 35,678,671 (GRCm39) missense probably benign 0.08
R2115:Parp14 UTSW 16 35,678,904 (GRCm39) missense probably benign 0.16
R2216:Parp14 UTSW 16 35,677,575 (GRCm39) missense probably benign 0.00
R2519:Parp14 UTSW 16 35,678,573 (GRCm39) missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35,674,118 (GRCm39) missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35,678,771 (GRCm39) missense probably benign 0.05
R4671:Parp14 UTSW 16 35,678,691 (GRCm39) missense probably benign 0.00
R4867:Parp14 UTSW 16 35,677,697 (GRCm39) missense probably benign 0.01
R4941:Parp14 UTSW 16 35,666,403 (GRCm39) missense probably benign
R4992:Parp14 UTSW 16 35,661,512 (GRCm39) missense probably benign 0.05
R5055:Parp14 UTSW 16 35,664,733 (GRCm39) missense probably benign 0.00
R5073:Parp14 UTSW 16 35,655,077 (GRCm39) missense probably damaging 0.99
R5170:Parp14 UTSW 16 35,677,649 (GRCm39) missense probably benign 0.21
R5422:Parp14 UTSW 16 35,686,545 (GRCm39) missense probably benign 0.01
R5543:Parp14 UTSW 16 35,655,137 (GRCm39) missense probably benign 0.00
R5549:Parp14 UTSW 16 35,661,505 (GRCm39) missense probably benign 0.00
R5553:Parp14 UTSW 16 35,677,306 (GRCm39) missense probably benign 0.01
R5691:Parp14 UTSW 16 35,683,909 (GRCm39) missense probably benign 0.12
R5774:Parp14 UTSW 16 35,678,780 (GRCm39) missense probably damaging 1.00
R5855:Parp14 UTSW 16 35,661,297 (GRCm39) nonsense probably null
R5942:Parp14 UTSW 16 35,659,737 (GRCm39) missense probably damaging 0.98
R5991:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6018:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6022:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6075:Parp14 UTSW 16 35,677,389 (GRCm39) missense probably damaging 0.99
R6395:Parp14 UTSW 16 35,676,918 (GRCm39) missense probably benign 0.00
R6525:Parp14 UTSW 16 35,680,811 (GRCm39) missense probably benign 0.05
R6683:Parp14 UTSW 16 35,655,047 (GRCm39) missense probably damaging 1.00
R7525:Parp14 UTSW 16 35,677,861 (GRCm39) missense probably benign 0.00
R8011:Parp14 UTSW 16 35,677,004 (GRCm39) missense probably benign 0.00
R8192:Parp14 UTSW 16 35,691,584 (GRCm39) missense probably benign 0.01
R8367:Parp14 UTSW 16 35,678,124 (GRCm39) missense probably benign 0.36
R8526:Parp14 UTSW 16 35,661,307 (GRCm39) missense possibly damaging 0.87
R8751:Parp14 UTSW 16 35,677,181 (GRCm39) missense probably benign 0.32
R8962:Parp14 UTSW 16 35,677,187 (GRCm39) missense probably damaging 1.00
R9231:Parp14 UTSW 16 35,661,583 (GRCm39) missense probably damaging 0.98
R9363:Parp14 UTSW 16 35,678,586 (GRCm39) missense possibly damaging 0.90
R9366:Parp14 UTSW 16 35,659,630 (GRCm39) critical splice donor site probably null
R9379:Parp14 UTSW 16 35,680,853 (GRCm39) missense probably benign 0.08
R9562:Parp14 UTSW 16 35,677,775 (GRCm39) missense probably benign 0.16
R9565:Parp14 UTSW 16 35,677,775 (GRCm39) missense probably benign 0.16
R9696:Parp14 UTSW 16 35,661,252 (GRCm39) missense probably damaging 0.96
R9696:Parp14 UTSW 16 35,661,251 (GRCm39) missense possibly damaging 0.67
X0026:Parp14 UTSW 16 35,677,527 (GRCm39) nonsense probably null
X0060:Parp14 UTSW 16 35,655,077 (GRCm39) missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35,661,956 (GRCm39) missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35,665,708 (GRCm39) missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35,691,573 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACATACCTGGAAAACTGTGTGC -3'
(R):5'- AGGAAATGCTCAACAGGACC -3'

Sequencing Primer
(F):5'- CCAAAACCAGGGTGTTCTTTTTG -3'
(R):5'- CAGGACCCAAACGTAGTAGC -3'
Posted On 2017-06-26