Incidental Mutation 'R0515:Cd96'
ID48198
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene NameCD96 antigen
Synonyms1700109I12Rik, Tactile
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location46035657-46120251 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 46063905 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
Predicted Effect probably benign
Transcript: ENSMUST00000023336
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 46071799 missense possibly damaging 0.85
IGL00588:Cd96 APN 16 46038554 missense probably benign 0.04
IGL00916:Cd96 APN 16 46041312 missense probably benign 0.07
IGL01080:Cd96 APN 16 46049693 missense possibly damaging 0.67
IGL01538:Cd96 APN 16 46109127 missense possibly damaging 0.67
IGL02350:Cd96 APN 16 46069776 splice site probably benign
IGL02357:Cd96 APN 16 46069776 splice site probably benign
IGL02892:Cd96 APN 16 46049797 critical splice acceptor site probably null
R0119:Cd96 UTSW 16 46038579 splice site probably benign
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0655:Cd96 UTSW 16 46099119 missense probably benign 0.06
R0684:Cd96 UTSW 16 46117790 missense possibly damaging 0.96
R0838:Cd96 UTSW 16 46117926 missense probably damaging 1.00
R1531:Cd96 UTSW 16 46117806 missense probably benign 0.03
R1664:Cd96 UTSW 16 46118001 missense possibly damaging 0.95
R1791:Cd96 UTSW 16 46117999 nonsense probably null
R1840:Cd96 UTSW 16 46099092 missense probably benign 0.36
R1873:Cd96 UTSW 16 46117972 missense probably damaging 1.00
R2895:Cd96 UTSW 16 46117805 missense probably benign 0.43
R2906:Cd96 UTSW 16 46051487 missense possibly damaging 0.56
R4291:Cd96 UTSW 16 46071749 missense probably damaging 0.98
R5112:Cd96 UTSW 16 46098938 missense probably benign
R5261:Cd96 UTSW 16 46069653 missense probably benign 0.39
R5274:Cd96 UTSW 16 46069703 missense possibly damaging 0.78
R5934:Cd96 UTSW 16 46117903 missense probably benign 0.43
R6002:Cd96 UTSW 16 46117986 missense possibly damaging 0.61
R6758:Cd96 UTSW 16 46118004 missense possibly damaging 0.50
R6992:Cd96 UTSW 16 46049724 missense possibly damaging 0.65
R7239:Cd96 UTSW 16 46109114 missense probably damaging 1.00
R7308:Cd96 UTSW 16 46071734 critical splice donor site probably null
R7316:Cd96 UTSW 16 46069653 missense probably benign 0.39
R7355:Cd96 UTSW 16 46041292 missense possibly damaging 0.51
R7553:Cd96 UTSW 16 46052021 missense probably damaging 1.00
X0017:Cd96 UTSW 16 46049774 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGACGTACAACAGACACGGAC -3'
(R):5'- TCACTGCCTACTGTAGAGCAAGCC -3'

Sequencing Primer
(F):5'- ttatttGACTCCACAGTGAGAATATG -3'
(R):5'- CCTCAATACTGGTTTGCCAGATAG -3'
Posted On2013-06-12