Incidental Mutation 'R5990:Pcx'
ID 481986
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Name pyruvate carboxylase
Synonyms Pc
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5990 (G1)
Quality Score 211.009
Status Validated
Chromosome 19
Chromosomal Location 4560500-4671780 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4671294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1172 (D1172G)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025823] [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000177696] [ENSMUST00000224726] [ENSMUST00000224675] [ENSMUST00000225375] [ENSMUST00000225896] [ENSMUST00000225476] [ENSMUST00000225264] [ENSMUST00000224707]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025823
SMART Domains Protein: ENSMUSP00000025823
Gene: ENSMUSG00000024889

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
Pfam:Abi 147 267 1.4e-19 PFAM
transmembrane domain 283 302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068004
AA Change: D1173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: D1173G

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113825
AA Change: D1172G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: D1172G

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177696
SMART Domains Protein: ENSMUSP00000136515
Gene: ENSMUSG00000071691

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF4554 274 719 5.3e-206 PFAM
low complexity region 720 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223788
Predicted Effect probably damaging
Transcript: ENSMUST00000224726
AA Change: D1172G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224675
Predicted Effect probably benign
Transcript: ENSMUST00000225375
Predicted Effect probably benign
Transcript: ENSMUST00000225896
Predicted Effect probably benign
Transcript: ENSMUST00000225476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225285
Predicted Effect probably benign
Transcript: ENSMUST00000225264
Predicted Effect probably benign
Transcript: ENSMUST00000224707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226012
Meta Mutation Damage Score 0.9518 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Xrcc1 G A 7: 24,267,293 (GRCm39) V381M probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4,670,965 (GRCm39) missense probably benign 0.02
IGL01339:Pcx APN 19 4,670,263 (GRCm39) splice site probably null
IGL01373:Pcx APN 19 4,670,263 (GRCm39) splice site probably null
IGL01704:Pcx APN 19 4,671,088 (GRCm39) missense probably damaging 1.00
IGL02223:Pcx APN 19 4,652,006 (GRCm39) missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4,653,157 (GRCm39) missense probably damaging 1.00
R0098:Pcx UTSW 19 4,651,775 (GRCm39) splice site probably benign
R0098:Pcx UTSW 19 4,651,775 (GRCm39) splice site probably benign
R0211:Pcx UTSW 19 4,670,227 (GRCm39) missense probably damaging 1.00
R0211:Pcx UTSW 19 4,670,227 (GRCm39) missense probably damaging 1.00
R0398:Pcx UTSW 19 4,651,638 (GRCm39) missense probably benign 0.35
R0414:Pcx UTSW 19 4,657,670 (GRCm39) missense possibly damaging 0.60
R1402:Pcx UTSW 19 4,652,058 (GRCm39) missense possibly damaging 0.59
R1402:Pcx UTSW 19 4,652,058 (GRCm39) missense possibly damaging 0.59
R1479:Pcx UTSW 19 4,652,052 (GRCm39) missense probably damaging 1.00
R1543:Pcx UTSW 19 4,652,251 (GRCm39) missense probably damaging 1.00
R1559:Pcx UTSW 19 4,669,114 (GRCm39) missense probably damaging 1.00
R1607:Pcx UTSW 19 4,653,187 (GRCm39) missense possibly damaging 0.89
R1833:Pcx UTSW 19 4,669,132 (GRCm39) missense probably damaging 0.98
R1866:Pcx UTSW 19 4,671,249 (GRCm39) missense possibly damaging 0.58
R2131:Pcx UTSW 19 4,652,579 (GRCm39) missense probably benign 0.00
R2172:Pcx UTSW 19 4,670,909 (GRCm39) missense probably benign 0.17
R2224:Pcx UTSW 19 4,668,026 (GRCm39) missense possibly damaging 0.46
R2226:Pcx UTSW 19 4,668,026 (GRCm39) missense possibly damaging 0.46
R2280:Pcx UTSW 19 4,654,571 (GRCm39) missense probably damaging 1.00
R3950:Pcx UTSW 19 4,667,995 (GRCm39) missense probably benign 0.00
R3952:Pcx UTSW 19 4,667,995 (GRCm39) missense probably benign 0.00
R4205:Pcx UTSW 19 4,669,194 (GRCm39) missense possibly damaging 0.95
R4409:Pcx UTSW 19 4,660,031 (GRCm39) missense possibly damaging 0.65
R4670:Pcx UTSW 19 4,669,916 (GRCm39) missense probably damaging 1.00
R4691:Pcx UTSW 19 4,669,505 (GRCm39) missense probably damaging 0.99
R4728:Pcx UTSW 19 4,653,124 (GRCm39) missense probably damaging 1.00
R4808:Pcx UTSW 19 4,670,956 (GRCm39) missense probably benign 0.00
R5200:Pcx UTSW 19 4,668,532 (GRCm39) missense probably damaging 1.00
R5454:Pcx UTSW 19 4,652,504 (GRCm39) missense probably damaging 1.00
R5621:Pcx UTSW 19 4,669,195 (GRCm39) missense possibly damaging 0.59
R6519:Pcx UTSW 19 4,652,239 (GRCm39) missense possibly damaging 0.64
R6526:Pcx UTSW 19 4,654,523 (GRCm39) missense probably benign 0.44
R7202:Pcx UTSW 19 4,652,361 (GRCm39) missense possibly damaging 0.47
R7423:Pcx UTSW 19 4,671,206 (GRCm39) missense probably benign 0.00
R7473:Pcx UTSW 19 4,669,589 (GRCm39) nonsense probably null
R7654:Pcx UTSW 19 4,565,697 (GRCm39) splice site probably null
R7963:Pcx UTSW 19 4,652,034 (GRCm39) missense probably damaging 1.00
R8272:Pcx UTSW 19 4,651,758 (GRCm39) missense probably damaging 1.00
R8693:Pcx UTSW 19 4,652,039 (GRCm39) missense probably damaging 1.00
R8781:Pcx UTSW 19 4,670,980 (GRCm39) missense probably damaging 1.00
R8829:Pcx UTSW 19 4,651,968 (GRCm39) missense probably damaging 1.00
R9084:Pcx UTSW 19 4,669,868 (GRCm39) missense probably damaging 1.00
R9334:Pcx UTSW 19 4,670,532 (GRCm39) missense probably benign 0.31
R9462:Pcx UTSW 19 4,651,970 (GRCm39) missense probably benign 0.00
R9540:Pcx UTSW 19 4,651,682 (GRCm39) missense probably benign
R9650:Pcx UTSW 19 4,657,714 (GRCm39) missense probably damaging 1.00
Z1176:Pcx UTSW 19 4,669,101 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCCATCCCAAGGCTTTGAAGG -3'
(R):5'- AGGCCATTGCAGGTAGTGTG -3'

Sequencing Primer
(F):5'- CATCCCAAGGCTTTGAAGGATGTG -3'
(R):5'- CCATTGCAGGTAGTGTGTGTGC -3'
Posted On 2017-06-26