Incidental Mutation 'R0515:Gpank1'
ID48201
Institutional Source Beutler Lab
Gene Symbol Gpank1
Ensembl Gene ENSMUSG00000092417
Gene NameG patch domain and ankyrin repeats 1
SynonymsG5, Bat4, D17H6S54E
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35121455-35124814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35123499 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 149 (A149S)
Ref Sequence ENSEMBL: ENSMUSP00000135684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025246] [ENSMUST00000052167] [ENSMUST00000061859] [ENSMUST00000165306] [ENSMUST00000172765] [ENSMUST00000173043] [ENSMUST00000173114] [ENSMUST00000173380] [ENSMUST00000173915] [ENSMUST00000174024] [ENSMUST00000174306] [ENSMUST00000174779]
Predicted Effect probably benign
Transcript: ENSMUST00000025246
SMART Domains Protein: ENSMUSP00000025246
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052167
AA Change: A172S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056646
Gene: ENSMUSG00000092417
AA Change: A172S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 82 99 N/A INTRINSIC
ANK 156 186 4.36e-1 SMART
G_patch 269 315 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061859
SMART Domains Protein: ENSMUSP00000061264
Gene: ENSMUSG00000043311

DomainStartEndE-ValueType
Pfam:DUF4661 16 264 8.3e-141 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165306
AA Change: A149S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133240
Gene: ENSMUSG00000092417
AA Change: A149S

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 4.36e-1 SMART
G_patch 246 292 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172765
SMART Domains Protein: ENSMUSP00000134523
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 29 206 6.86e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173043
AA Change: A149S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135684
Gene: ENSMUSG00000092417
AA Change: A149S

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173114
SMART Domains Protein: ENSMUSP00000134218
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173189
Predicted Effect probably benign
Transcript: ENSMUST00000173380
SMART Domains Protein: ENSMUSP00000134694
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173576
Predicted Effect probably benign
Transcript: ENSMUST00000173915
SMART Domains Protein: ENSMUSP00000133425
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 58 6.45e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174024
SMART Domains Protein: ENSMUSP00000134673
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 169 5.07e-71 SMART
Blast:CK_II_beta 189 220 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174306
SMART Domains Protein: ENSMUSP00000134413
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 122 3.01e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174311
Predicted Effect probably benign
Transcript: ENSMUST00000174779
SMART Domains Protein: ENSMUSP00000133684
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 1 140 2.47e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177018
Meta Mutation Damage Score 0.4911 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in a cluster of HLA-B-associated transcripts, which is included in the human major histocompatability complex III region. This gene encodes a protein which is thought to play a role in immunity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Gpank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1055:Gpank1 UTSW 17 35124308 missense probably damaging 1.00
R2850:Gpank1 UTSW 17 35124581 missense probably benign 0.21
R4274:Gpank1 UTSW 17 35124269 missense probably benign 0.22
R5716:Gpank1 UTSW 17 35123253 missense probably damaging 0.97
R6285:Gpank1 UTSW 17 35124290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGTAGTTCCTCTAAGCCCCAG -3'
(R):5'- ATGGGTGTAAGTGAAGGCTCCCTC -3'

Sequencing Primer
(F):5'- TCTAAGCCCCAGAGAGCTG -3'
(R):5'- TGAAGGCTCCCTCCTCAC -3'
Posted On2013-06-12