Mutagenetix > Incidental Mutation

Incidental Mutation 'R5991:Ryr1'

482012

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

calcium release channel isoform 1, Ryr, skrr

MMRRC Submission

044171-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5991 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28702765-28824599 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 28804035 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 584 (N584K)

Ref Sequence

ENSEMBL: ENSMUSP00000149042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000032813
AA Change: N577K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: N577K

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179893
AA Change: N577K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: N577K

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214374
AA Change: N584K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.6480

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars1	G	A	8: 111,777,032 (GRCm39)	R683Q	probably damaging	Het
Adam8	T	A	7: 139,570,200 (GRCm39)	H69L	probably damaging	Het
Bbs2	G	T	8: 94,824,914 (GRCm39)	R23S	probably benign	Het
Bod1l	A	T	5: 41,974,206 (GRCm39)	C2369*	probably null	Het
Capn11	G	T	17: 45,970,278 (GRCm39)		probably null	Het
Carmil2	A	G	8: 106,418,023 (GRCm39)	Q679R	probably null	Het
Cep120	T	C	18: 53,854,870 (GRCm39)	I422V	probably benign	Het
Cnot7	A	C	8: 40,948,696 (GRCm39)		probably null	Het
Col1a1	T	C	11: 94,828,745 (GRCm39)	V29A	unknown	Het
Dnttip1	A	T	2: 164,596,100 (GRCm39)	Q115L	possibly damaging	Het
Dyrk4	A	G	6: 126,857,188 (GRCm39)	V497A	probably benign	Het
Ep300	A	G	15: 81,532,667 (GRCm39)	D1635G	unknown	Het
Ercc5	T	A	1: 44,219,990 (GRCm39)	C1087*	probably null	Het
Fap	A	T	2: 62,348,865 (GRCm39)	M517K	probably damaging	Het
Focad	C	A	4: 88,319,256 (GRCm39)	D1574E	possibly damaging	Het
Fsip2	C	T	2: 82,820,812 (GRCm39)	P5515L	probably benign	Het
Gpr158	T	C	2: 21,373,319 (GRCm39)	Y85H	probably damaging	Het
Hc	A	G	2: 34,896,117 (GRCm39)	V1222A	possibly damaging	Het
Hipk3	C	T	2: 104,268,328 (GRCm39)	M546I	probably damaging	Het
Jup	T	C	11: 100,270,395 (GRCm39)	N371D	possibly damaging	Het
Ltbp4	A	G	7: 27,008,741 (GRCm39)	Y1262H	probably damaging	Het
Lyar	A	G	5: 38,385,209 (GRCm39)	E83G	probably damaging	Het
Lyg2	C	T	1: 37,954,800 (GRCm39)		probably null	Het
Mtmr11	T	A	3: 96,075,905 (GRCm39)		probably null	Het
Myct1	A	T	10: 5,554,426 (GRCm39)	R98*	probably null	Het
Nol11	T	C	11: 107,061,971 (GRCm39)	T612A	probably benign	Het
Or2l5	T	C	16: 19,333,507 (GRCm39)	N293S	probably damaging	Het
Or4b1d	T	A	2: 89,968,578 (GRCm39)	K302*	probably null	Het
Or4c113	C	T	2: 88,885,126 (GRCm39)	V215I	probably benign	Het
Or4f61	C	T	2: 111,922,960 (GRCm39)	V29M	probably benign	Het
Or5m9	A	G	2: 85,877,254 (GRCm39)	I143V	probably benign	Het
Parp14	G	A	16: 35,661,827 (GRCm39)	P1403S	probably benign	Het
Pcdhb3	T	C	18: 37,434,561 (GRCm39)	S176P	probably benign	Het
Pdcd1lg2	C	T	19: 29,431,867 (GRCm39)	R212W	probably benign	Het
Plin3	T	C	17: 56,593,576 (GRCm39)	Y46C	probably damaging	Het
Rfx7	G	A	9: 72,526,820 (GRCm39)	E1337K	possibly damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Scmh1	T	C	4: 120,379,817 (GRCm39)	V544A	probably benign	Het
Sdk2	G	A	11: 113,834,080 (GRCm39)	T34M	probably damaging	Het
Serpinb9e	T	A	13: 33,443,790 (GRCm39)	L270H	probably damaging	Het
Shoc2	T	A	19: 53,991,480 (GRCm39)	N248K	probably damaging	Het
Sirpd	G	T	3: 15,385,818 (GRCm39)	A28E	probably benign	Het
Slc25a4	T	C	8: 46,662,373 (GRCm39)	Y95C	probably damaging	Het
Slc4a1ap	A	G	5: 31,691,413 (GRCm39)	N403S	possibly damaging	Het
Spink10	T	A	18: 62,790,956 (GRCm39)	W7R	probably null	Het
Ssrp1	A	G	2: 84,872,640 (GRCm39)	K426R	possibly damaging	Het
Tbc1d24	G	A	17: 24,428,043 (GRCm39)		probably benign	Het
Tead3	A	T	17: 28,553,352 (GRCm39)		probably null	Het
Timd4	A	G	11: 46,734,030 (GRCm39)	*344W	probably null	Het
Tmem181a	T	A	17: 6,339,312 (GRCm39)	W115R	probably damaging	Het
Tmem245	G	A	4: 56,916,733 (GRCm39)	T65I	probably damaging	Het
Vmn1r12	G	C	6: 57,136,640 (GRCm39)	V202L	probably damaging	Het
Vmn1r80	A	G	7: 11,927,423 (GRCm39)	T178A	probably benign	Het
Vps33b	T	A	7: 79,933,162 (GRCm39)		probably null	Het
Zmym6	T	A	4: 127,002,266 (GRCm39)		probably null	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	28,802,235 (GRCm39)	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	28,824,385 (GRCm39)	splice site	probably null
IGL00427:Ryr1	APN	7	28,804,162 (GRCm39)	splice site	probably benign
IGL00559:Ryr1	APN	7	28,711,667 (GRCm39)	splice site	probably benign
IGL00803:Ryr1	APN	7	28,769,070 (GRCm39)	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	28,723,654 (GRCm39)	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	28,719,620 (GRCm39)	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	28,781,968 (GRCm39)	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	28,799,627 (GRCm39)	splice site	probably benign
IGL01385:Ryr1	APN	7	28,756,410 (GRCm39)	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	28,751,762 (GRCm39)	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	28,774,652 (GRCm39)	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	28,790,501 (GRCm39)	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	28,778,022 (GRCm39)	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	28,759,235 (GRCm39)	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	28,771,083 (GRCm39)	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	28,751,440 (GRCm39)	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	28,793,472 (GRCm39)	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	28,778,121 (GRCm39)	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	28,804,491 (GRCm39)	splice site	probably benign
IGL02472:Ryr1	APN	7	28,740,269 (GRCm39)	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	28,815,024 (GRCm39)	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	28,719,188 (GRCm39)	missense	unknown
IGL02672:Ryr1	APN	7	28,703,944 (GRCm39)	unclassified	probably benign
IGL02677:Ryr1	APN	7	28,810,033 (GRCm39)	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	28,768,975 (GRCm39)	splice site	probably benign
IGL02751:Ryr1	APN	7	28,778,199 (GRCm39)	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	28,748,220 (GRCm39)	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	28,760,965 (GRCm39)	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	28,796,884 (GRCm39)	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	28,759,478 (GRCm39)	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	28,743,318 (GRCm39)	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	28,770,084 (GRCm39)	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	28,782,911 (GRCm39)	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	28,804,018 (GRCm39)	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	28,774,624 (GRCm39)	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	28,802,389 (GRCm39)	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	28,715,211 (GRCm39)	missense	unknown
IGL03146:Ryr1	APN	7	28,793,457 (GRCm39)	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	28,804,465 (GRCm39)	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	28,759,280 (GRCm39)	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	28,746,967 (GRCm39)	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	28,704,992 (GRCm39)	unclassified	probably benign
R0066:Ryr1	UTSW	7	28,704,992 (GRCm39)	unclassified	probably benign
R0069:Ryr1	UTSW	7	28,809,930 (GRCm39)	splice site	probably benign
R0148:Ryr1	UTSW	7	28,751,460 (GRCm39)	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	28,740,104 (GRCm39)	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	28,767,013 (GRCm39)	splice site	probably benign
R0387:Ryr1	UTSW	7	28,782,792 (GRCm39)	splice site	probably benign
R0454:Ryr1	UTSW	7	28,735,500 (GRCm39)	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	28,703,218 (GRCm39)	splice site	probably benign
R0533:Ryr1	UTSW	7	28,778,205 (GRCm39)	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	28,735,501 (GRCm39)	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	28,804,220 (GRCm39)	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	28,774,034 (GRCm39)	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	28,799,614 (GRCm39)	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	28,740,104 (GRCm39)	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	28,709,122 (GRCm39)	missense	unknown
R1052:Ryr1	UTSW	7	28,795,683 (GRCm39)	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	28,785,534 (GRCm39)	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	28,815,437 (GRCm39)	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	28,770,046 (GRCm39)	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	28,782,962 (GRCm39)	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	28,791,600 (GRCm39)	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	28,761,616 (GRCm39)	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	28,794,915 (GRCm39)	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	28,793,686 (GRCm39)	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	28,801,163 (GRCm39)	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	28,735,503 (GRCm39)	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	28,815,579 (GRCm39)	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	28,777,989 (GRCm39)	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	28,746,928 (GRCm39)	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	28,801,295 (GRCm39)	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	28,767,046 (GRCm39)	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	28,779,236 (GRCm39)	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	28,708,977 (GRCm39)	missense	unknown
R1861:Ryr1	UTSW	7	28,708,977 (GRCm39)	missense	unknown
R1921:Ryr1	UTSW	7	28,754,369 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	28,758,897 (GRCm39)	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	28,759,056 (GRCm39)	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	28,789,575 (GRCm39)	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	28,767,867 (GRCm39)	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	28,719,166 (GRCm39)	missense	unknown
R2291:Ryr1	UTSW	7	28,798,202 (GRCm39)	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	28,774,718 (GRCm39)	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	28,802,967 (GRCm39)	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	28,735,551 (GRCm39)	missense	possibly damaging	0.94
R2571:Ryr1	UTSW	7	28,708,987 (GRCm39)	missense	unknown
R2885:Ryr1	UTSW	7	28,774,223 (GRCm39)	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	28,774,223 (GRCm39)	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	28,778,166 (GRCm39)	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	28,745,071 (GRCm39)	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	28,774,373 (GRCm39)	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	28,769,075 (GRCm39)	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	28,756,422 (GRCm39)	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	28,756,422 (GRCm39)	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	28,719,577 (GRCm39)	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	28,772,327 (GRCm39)	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	28,794,549 (GRCm39)	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	28,785,356 (GRCm39)	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	28,761,576 (GRCm39)	nonsense	probably null
R4257:Ryr1	UTSW	7	28,781,875 (GRCm39)	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	28,782,484 (GRCm39)	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	28,793,667 (GRCm39)	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	28,789,581 (GRCm39)	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	28,798,160 (GRCm39)	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	28,804,433 (GRCm39)	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	28,774,005 (GRCm39)	intron	probably benign
R4642:Ryr1	UTSW	7	28,785,463 (GRCm39)	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	28,759,256 (GRCm39)	missense	probably null	0.99
R4707:Ryr1	UTSW	7	28,745,087 (GRCm39)	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	28,785,258 (GRCm39)	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	28,704,246 (GRCm39)	unclassified	probably benign
R4770:Ryr1	UTSW	7	28,808,707 (GRCm39)	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	28,794,522 (GRCm39)	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	28,719,408 (GRCm39)	missense	unknown
R4933:Ryr1	UTSW	7	28,803,723 (GRCm39)	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	28,767,520 (GRCm39)	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	28,768,998 (GRCm39)	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	28,778,208 (GRCm39)	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	28,768,540 (GRCm39)	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	28,802,234 (GRCm39)	splice site	probably null
R5013:Ryr1	UTSW	7	28,802,234 (GRCm39)	splice site	probably null
R5137:Ryr1	UTSW	7	28,801,283 (GRCm39)	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	28,767,118 (GRCm39)	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	28,735,553 (GRCm39)	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	28,815,023 (GRCm39)	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	28,767,907 (GRCm39)	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	28,816,841 (GRCm39)	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	28,809,237 (GRCm39)	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	28,771,386 (GRCm39)	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	28,723,448 (GRCm39)	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	28,768,453 (GRCm39)	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	28,785,610 (GRCm39)	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	28,715,148 (GRCm39)	missense	unknown
R5575:Ryr1	UTSW	7	28,778,118 (GRCm39)	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	28,811,399 (GRCm39)	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	28,790,514 (GRCm39)	splice site	probably null
R5918:Ryr1	UTSW	7	28,708,577 (GRCm39)	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	28,803,785 (GRCm39)	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	28,746,290 (GRCm39)	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	28,815,552 (GRCm39)	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	28,771,349 (GRCm39)	missense	probably null	0.98
R5992:Ryr1	UTSW	7	28,767,062 (GRCm39)	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	28,723,666 (GRCm39)	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	28,786,863 (GRCm39)	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	28,771,398 (GRCm39)	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	28,775,664 (GRCm39)	missense	probably null	1.00
R6147:Ryr1	UTSW	7	28,785,339 (GRCm39)	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	28,815,606 (GRCm39)	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	28,786,853 (GRCm39)	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	28,774,682 (GRCm39)	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	28,759,120 (GRCm39)	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	28,776,503 (GRCm39)	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	28,715,079 (GRCm39)	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	28,746,266 (GRCm39)	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	28,794,917 (GRCm39)	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	28,737,770 (GRCm39)	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	28,816,829 (GRCm39)	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	28,764,299 (GRCm39)	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	28,723,741 (GRCm39)	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	28,751,751 (GRCm39)	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	28,808,812 (GRCm39)	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	28,793,607 (GRCm39)	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	28,803,068 (GRCm39)	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	28,746,279 (GRCm39)	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	28,794,807 (GRCm39)	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	28,751,440 (GRCm39)	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	28,758,936 (GRCm39)	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	28,785,180 (GRCm39)	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	28,713,292 (GRCm39)	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	28,785,295 (GRCm39)	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	28,794,630 (GRCm39)	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	28,778,010 (GRCm39)	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	28,735,528 (GRCm39)	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	28,798,210 (GRCm39)	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	28,767,055 (GRCm39)	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	28,804,257 (GRCm39)	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	28,702,985 (GRCm39)	splice site	probably null
R7916:Ryr1	UTSW	7	28,790,364 (GRCm39)	nonsense	probably null
R7922:Ryr1	UTSW	7	28,796,649 (GRCm39)	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	28,795,596 (GRCm39)	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	28,702,968 (GRCm39)	missense	unknown
R8052:Ryr1	UTSW	7	28,782,810 (GRCm39)	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	28,708,626 (GRCm39)	missense	unknown
R8116:Ryr1	UTSW	7	28,810,308 (GRCm39)	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	28,790,457 (GRCm39)	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	28,789,650 (GRCm39)	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	28,768,546 (GRCm39)	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	28,764,064 (GRCm39)	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	28,715,142 (GRCm39)	missense	unknown
R8454:Ryr1	UTSW	7	28,715,142 (GRCm39)	missense	unknown
R8487:Ryr1	UTSW	7	28,740,292 (GRCm39)	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	28,769,509 (GRCm39)	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	28,704,239 (GRCm39)	unclassified	probably benign
R8678:Ryr1	UTSW	7	28,776,489 (GRCm39)	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	28,751,753 (GRCm39)	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	28,816,802 (GRCm39)	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	28,791,693 (GRCm39)	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	28,815,557 (GRCm39)	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	28,776,297 (GRCm39)	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	28,764,284 (GRCm39)	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	28,774,091 (GRCm39)	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	28,808,638 (GRCm39)	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	28,771,340 (GRCm39)	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	28,789,640 (GRCm39)	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	28,801,358 (GRCm39)	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	28,790,422 (GRCm39)	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	28,803,989 (GRCm39)	nonsense	probably null
R9123:Ryr1	UTSW	7	28,771,229 (GRCm39)	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	28,769,283 (GRCm39)	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	28,776,471 (GRCm39)	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	28,794,524 (GRCm39)	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	28,785,187 (GRCm39)	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	28,801,277 (GRCm39)	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	28,743,313 (GRCm39)	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	28,751,813 (GRCm39)	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	28,802,254 (GRCm39)	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	28,802,389 (GRCm39)	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	28,717,387 (GRCm39)	missense	unknown
R9333:Ryr1	UTSW	7	28,774,214 (GRCm39)	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	28,768,068 (GRCm39)	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	28,772,510 (GRCm39)	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	28,777,965 (GRCm39)	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	28,723,600 (GRCm39)	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	28,715,138 (GRCm39)	missense	unknown
R9664:Ryr1	UTSW	7	28,759,092 (GRCm39)	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	28,774,664 (GRCm39)	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	28,760,956 (GRCm39)	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	28,802,923 (GRCm39)	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	28,785,460 (GRCm39)	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	28,719,639 (GRCm39)	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	28,801,347 (GRCm39)	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	28,748,217 (GRCm39)	nonsense	probably null
Z1177:Ryr1	UTSW	7	28,717,410 (GRCm39)	missense	unknown
Z1186:Ryr1	UTSW	7	28,781,902 (GRCm39)	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- AGGACCTGGAAGTCAAGTTCAG -3'
(R):5'- CTTCTCCACAAACTTGGATTGGC -3'

Sequencing Primer
(F):5'- CCTGGAAGTCAAGTTCAGGGGTC -3'
(R):5'- CCACAAACTTGGATTGGCTGGTC -3'

Posted On

2017-06-26