Incidental Mutation 'R0515:Dcp2'
ID48202
Institutional Source Beutler Lab
Gene Symbol Dcp2
Ensembl Gene ENSMUSG00000024472
Gene Namedecapping mRNA 2
Synonyms
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44380502-44424969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44399731 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 105 (L105F)
Ref Sequence ENSEMBL: ENSMUSP00000025350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025350] [ENSMUST00000202306]
Predicted Effect probably benign
Transcript: ENSMUST00000025350
AA Change: L105F

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472
AA Change: L105F

DomainStartEndE-ValueType
DCP2 10 94 4.23e-50 SMART
Pfam:NUDIX 97 219 6.5e-17 PFAM
low complexity region 240 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202306
SMART Domains Protein: ENSMUSP00000144010
Gene: ENSMUSG00000024472

DomainStartEndE-ValueType
DCP2 10 82 5.7e-28 SMART
Meta Mutation Damage Score 0.4526 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Dcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02801:Dcp2 APN 18 44417711 missense probably damaging 1.00
belay UTSW 18 44395952 missense probably damaging 0.99
PIT4431001:Dcp2 UTSW 18 44412571 missense probably benign 0.15
R0051:Dcp2 UTSW 18 44405374 splice site probably benign
R0761:Dcp2 UTSW 18 44410233 missense probably benign 0.01
R1696:Dcp2 UTSW 18 44400324 missense probably damaging 1.00
R1803:Dcp2 UTSW 18 44395917 missense probably damaging 1.00
R1928:Dcp2 UTSW 18 44405571 critical splice donor site probably null
R1964:Dcp2 UTSW 18 44395971 missense possibly damaging 0.50
R2014:Dcp2 UTSW 18 44410296 missense probably benign 0.00
R2209:Dcp2 UTSW 18 44405514 nonsense probably null
R4167:Dcp2 UTSW 18 44395967 missense probably damaging 1.00
R4668:Dcp2 UTSW 18 44415362 splice site probably null
R4877:Dcp2 UTSW 18 44417592 missense probably benign 0.11
R5147:Dcp2 UTSW 18 44417595 nonsense probably null
R5559:Dcp2 UTSW 18 44405487 missense probably damaging 1.00
R6533:Dcp2 UTSW 18 44399664 missense probably benign 0.25
R7406:Dcp2 UTSW 18 44410187 missense probably benign 0.00
R7469:Dcp2 UTSW 18 44395952 missense probably damaging 0.99
R7850:Dcp2 UTSW 18 44400348 nonsense probably null
R7933:Dcp2 UTSW 18 44400348 nonsense probably null
R8054:Dcp2 UTSW 18 44405707 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGGGAGTCTAGCACTGATGATCCTTA -3'
(R):5'- ATGCAGGCAAAGCATCCAAAATTTAGTT -3'

Sequencing Primer
(F):5'- cacagtgtcactccagcc -3'
(R):5'- TCGGCCATCACATCACTAGA -3'
Posted On2013-06-12