Mutagenetix > Incidental Mutations

Incidental Mutation 'R5991:Olfr167'

482028

Institutional Source

Beutler Lab

Gene Symbol

Olfr167

Ensembl Gene

ENSMUSG00000045341

Gene Name

olfactory receptor 167

Synonyms

MOR272-1, GA_x54KRFPKG5P-15963726-15962788

MMRRC Submission

044171-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R5991 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19509558-19522266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19514757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 293 (N293S)

Ref Sequence

ENSEMBL: ENSMUSP00000150102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]

AlphaFold

Q8VGJ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000054606
AA Change: N293S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: N293S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	306	4.8e-46	PFAM
Pfam:7TM_GPCR_Srsx	33	295	1.2e-6	PFAM
Pfam:7tm_1	40	289	1.8e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214315
AA Change: N293S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217566

Meta Mutation Damage Score

0.5055

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	G	A	8: 111,050,400	R683Q	probably damaging	Het
Adam8	T	A	7: 139,990,287	H69L	probably damaging	Het
Bbs2	G	T	8: 94,098,286	R23S	probably benign	Het
Bod1l	A	T	5: 41,816,863	C2369*	probably null	Het
Capn11	G	T	17: 45,659,352		probably null	Het
Carmil2	A	G	8: 105,691,391	Q679R	probably null	Het
Cep120	T	C	18: 53,721,798	I422V	probably benign	Het
Cnot7	A	C	8: 40,495,655		probably null	Het
Col1a1	T	C	11: 94,937,919	V29A	unknown	Het
Dnttip1	A	T	2: 164,754,180	Q115L	possibly damaging	Het
Dyrk4	A	G	6: 126,880,225	V497A	probably benign	Het
Ep300	A	G	15: 81,648,466	D1635G	unknown	Het
Ercc5	T	A	1: 44,180,830	C1087*	probably null	Het
Fap	A	T	2: 62,518,521	M517K	probably damaging	Het
Focad	C	A	4: 88,401,019	D1574E	possibly damaging	Het
Fsip2	C	T	2: 82,990,468	P5515L	probably benign	Het
Gm9733	G	T	3: 15,320,758	A28E	probably benign	Het
Gpr158	T	C	2: 21,368,508	Y85H	probably damaging	Het
Hc	A	G	2: 35,006,105	V1222A	possibly damaging	Het
Hipk3	C	T	2: 104,437,983	M546I	probably damaging	Het
Jup	T	C	11: 100,379,569	N371D	possibly damaging	Het
Ltbp4	A	G	7: 27,309,316	Y1262H	probably damaging	Het
Lyar	A	G	5: 38,227,865	E83G	probably damaging	Het
Lyg2	C	T	1: 37,915,719		probably null	Het
Mtmr11	T	A	3: 96,168,589		probably null	Het
Myct1	A	T	10: 5,604,426	R98*	probably null	Het
Nol11	T	C	11: 107,171,145	T612A	probably benign	Het
Olfr1034	A	G	2: 86,046,910	I143V	probably benign	Het
Olfr1218	C	T	2: 89,054,782	V215I	probably benign	Het
Olfr1314	C	T	2: 112,092,615	V29M	probably benign	Het
Olfr32	T	A	2: 90,138,234	K302*	probably null	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Pcdhb3	T	C	18: 37,301,508	S176P	probably benign	Het
Pdcd1lg2	C	T	19: 29,454,467	R212W	probably benign	Het
Plin3	T	C	17: 56,286,576	Y46C	probably damaging	Het
Rfx7	G	A	9: 72,619,538	E1337K	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ryr1	G	T	7: 29,104,610	N584K	probably damaging	Het
Scmh1	T	C	4: 120,522,620	V544A	probably benign	Het
Sdk2	G	A	11: 113,943,254	T34M	probably damaging	Het
Serpinb9e	T	A	13: 33,259,807	L270H	probably damaging	Het
Shoc2	T	A	19: 54,003,049	N248K	probably damaging	Het
Slc25a4	T	C	8: 46,209,336	Y95C	probably damaging	Het
Slc4a1ap	A	G	5: 31,534,069	N403S	possibly damaging	Het
Spink10	T	A	18: 62,657,885	W7R	probably null	Het
Ssrp1	A	G	2: 85,042,296	K426R	possibly damaging	Het
Tbc1d24	G	A	17: 24,209,069		probably benign	Het
Tead3	A	T	17: 28,334,378		probably null	Het
Timd4	A	G	11: 46,843,203	*344W	probably null	Het
Tmem181a	T	A	17: 6,289,037	W115R	probably damaging	Het
Tmem245	G	A	4: 56,916,733	T65I	probably damaging	Het
Vmn1r12	G	C	6: 57,159,655	V202L	probably damaging	Het
Vmn1r80	A	G	7: 12,193,496	T178A	probably benign	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zmym6	T	A	4: 127,108,473		probably null	Het

Other mutations in Olfr167

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01535:Olfr167	APN	16	19515478	missense	probably benign	0.01
IGL02115:Olfr167	APN	16	19515103	missense	probably damaging	1.00
IGL02562:Olfr167	APN	16	19514964	missense	possibly damaging	0.74
BB008:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
BB018:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R0366:Olfr167	UTSW	16	19514848	missense	probably benign	0.13
R0673:Olfr167	UTSW	16	19515396	missense	probably damaging	1.00
R1187:Olfr167	UTSW	16	19515046	missense	probably benign	0.01
R1237:Olfr167	UTSW	16	19515625	missense	probably benign	0.01
R1975:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1977:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1997:Olfr167	UTSW	16	19515042	missense	probably damaging	1.00
R2225:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R2226:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R4078:Olfr167	UTSW	16	19515232	missense	possibly damaging	0.76
R5019:Olfr167	UTSW	16	19515535	missense	probably damaging	0.99
R5071:Olfr167	UTSW	16	19515027	missense	probably benign	0.00
R5278:Olfr167	UTSW	16	19515378	nonsense	probably null
R5415:Olfr167	UTSW	16	19515246	missense	possibly damaging	0.94
R5744:Olfr167	UTSW	16	19515336	missense	probably benign	0.00
R6151:Olfr167	UTSW	16	19515531	missense	probably damaging	1.00
R6540:Olfr167	UTSW	16	19514821	missense	probably benign
R7014:Olfr167	UTSW	16	19515456	missense	probably benign	0.20
R7145:Olfr167	UTSW	16	19514899	missense	probably damaging	0.99
R7535:Olfr167	UTSW	16	19514794	missense	probably damaging	1.00
R7677:Olfr167	UTSW	16	19514928	missense	probably benign	0.42
R7715:Olfr167	UTSW	16	19514730	missense	probably benign	0.00
R7931:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R8137:Olfr167	UTSW	16	19515096	missense	possibly damaging	0.89
R8671:Olfr167	UTSW	16	19515054	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TTAAGAGATCGATCCGAGTACTTAACC -3'
(R):5'- CTACCGTATGCATTCTAGGGCG -3'

Sequencing Primer
(F):5'- TCTGGATTCACGGAAGCA -3'
(R):5'- AAGAAGAAGGCCTATTCTACCTG -3'

Posted On

2017-06-26