Incidental Mutation 'R5991:Olfr167'
ID 482028
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission 044171-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R5991 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19514757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 293 (N293S)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000054606
AA Change: N293S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: N293S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214315
AA Change: N293S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Meta Mutation Damage Score 0.5055 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,050,400 R683Q probably damaging Het
Adam8 T A 7: 139,990,287 H69L probably damaging Het
Bbs2 G T 8: 94,098,286 R23S probably benign Het
Bod1l A T 5: 41,816,863 C2369* probably null Het
Capn11 G T 17: 45,659,352 probably null Het
Carmil2 A G 8: 105,691,391 Q679R probably null Het
Cep120 T C 18: 53,721,798 I422V probably benign Het
Cnot7 A C 8: 40,495,655 probably null Het
Col1a1 T C 11: 94,937,919 V29A unknown Het
Dnttip1 A T 2: 164,754,180 Q115L possibly damaging Het
Dyrk4 A G 6: 126,880,225 V497A probably benign Het
Ep300 A G 15: 81,648,466 D1635G unknown Het
Ercc5 T A 1: 44,180,830 C1087* probably null Het
Fap A T 2: 62,518,521 M517K probably damaging Het
Focad C A 4: 88,401,019 D1574E possibly damaging Het
Fsip2 C T 2: 82,990,468 P5515L probably benign Het
Gm9733 G T 3: 15,320,758 A28E probably benign Het
Gpr158 T C 2: 21,368,508 Y85H probably damaging Het
Hc A G 2: 35,006,105 V1222A possibly damaging Het
Hipk3 C T 2: 104,437,983 M546I probably damaging Het
Jup T C 11: 100,379,569 N371D possibly damaging Het
Ltbp4 A G 7: 27,309,316 Y1262H probably damaging Het
Lyar A G 5: 38,227,865 E83G probably damaging Het
Lyg2 C T 1: 37,915,719 probably null Het
Mtmr11 T A 3: 96,168,589 probably null Het
Myct1 A T 10: 5,604,426 R98* probably null Het
Nol11 T C 11: 107,171,145 T612A probably benign Het
Olfr1034 A G 2: 86,046,910 I143V probably benign Het
Olfr1218 C T 2: 89,054,782 V215I probably benign Het
Olfr1314 C T 2: 112,092,615 V29M probably benign Het
Olfr32 T A 2: 90,138,234 K302* probably null Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcdhb3 T C 18: 37,301,508 S176P probably benign Het
Pdcd1lg2 C T 19: 29,454,467 R212W probably benign Het
Plin3 T C 17: 56,286,576 Y46C probably damaging Het
Rfx7 G A 9: 72,619,538 E1337K possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr1 G T 7: 29,104,610 N584K probably damaging Het
Scmh1 T C 4: 120,522,620 V544A probably benign Het
Sdk2 G A 11: 113,943,254 T34M probably damaging Het
Serpinb9e T A 13: 33,259,807 L270H probably damaging Het
Shoc2 T A 19: 54,003,049 N248K probably damaging Het
Slc25a4 T C 8: 46,209,336 Y95C probably damaging Het
Slc4a1ap A G 5: 31,534,069 N403S possibly damaging Het
Spink10 T A 18: 62,657,885 W7R probably null Het
Ssrp1 A G 2: 85,042,296 K426R possibly damaging Het
Tbc1d24 G A 17: 24,209,069 probably benign Het
Tead3 A T 17: 28,334,378 probably null Het
Timd4 A G 11: 46,843,203 *344W probably null Het
Tmem181a T A 17: 6,289,037 W115R probably damaging Het
Tmem245 G A 4: 56,916,733 T65I probably damaging Het
Vmn1r12 G C 6: 57,159,655 V202L probably damaging Het
Vmn1r80 A G 7: 12,193,496 T178A probably benign Het
Vps33b T A 7: 80,283,414 probably null Het
Zmym6 T A 4: 127,108,473 probably null Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
R8671:Olfr167 UTSW 16 19515054 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTAAGAGATCGATCCGAGTACTTAACC -3'
(R):5'- CTACCGTATGCATTCTAGGGCG -3'

Sequencing Primer
(F):5'- TCTGGATTCACGGAAGCA -3'
(R):5'- AAGAAGAAGGCCTATTCTACCTG -3'
Posted On 2017-06-26