Incidental Mutation 'R5991:Tmem181a'
ID482030
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission 044171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5991 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6289037 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 115 (W115R)
Ref Sequence ENSEMBL: ENSMUSP00000156382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383]
Predicted Effect probably damaging
Transcript: ENSMUST00000088940
AA Change: W74R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: W74R

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228334
Predicted Effect probably damaging
Transcript: ENSMUST00000232383
AA Change: W115R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8889 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,050,400 R683Q probably damaging Het
Adam8 T A 7: 139,990,287 H69L probably damaging Het
Bbs2 G T 8: 94,098,286 R23S probably benign Het
Bod1l A T 5: 41,816,863 C2369* probably null Het
Capn11 G T 17: 45,659,352 probably null Het
Carmil2 A G 8: 105,691,391 Q679R probably null Het
Cep120 T C 18: 53,721,798 I422V probably benign Het
Cnot7 A C 8: 40,495,655 probably null Het
Col1a1 T C 11: 94,937,919 V29A unknown Het
Dnttip1 A T 2: 164,754,180 Q115L possibly damaging Het
Dyrk4 A G 6: 126,880,225 V497A probably benign Het
Ep300 A G 15: 81,648,466 D1635G unknown Het
Ercc5 T A 1: 44,180,830 C1087* probably null Het
Fap A T 2: 62,518,521 M517K probably damaging Het
Focad C A 4: 88,401,019 D1574E possibly damaging Het
Fsip2 C T 2: 82,990,468 P5515L probably benign Het
Gm9733 G T 3: 15,320,758 A28E probably benign Het
Gpr158 T C 2: 21,368,508 Y85H probably damaging Het
Hc A G 2: 35,006,105 V1222A possibly damaging Het
Hipk3 C T 2: 104,437,983 M546I probably damaging Het
Jup T C 11: 100,379,569 N371D possibly damaging Het
Ltbp4 A G 7: 27,309,316 Y1262H probably damaging Het
Lyar A G 5: 38,227,865 E83G probably damaging Het
Lyg2 C T 1: 37,915,719 probably null Het
Mtmr11 T A 3: 96,168,589 probably null Het
Myct1 A T 10: 5,604,426 R98* probably null Het
Nol11 T C 11: 107,171,145 T612A probably benign Het
Olfr1034 A G 2: 86,046,910 I143V probably benign Het
Olfr1218 C T 2: 89,054,782 V215I probably benign Het
Olfr1314 C T 2: 112,092,615 V29M probably benign Het
Olfr167 T C 16: 19,514,757 N293S probably damaging Het
Olfr32 T A 2: 90,138,234 K302* probably null Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcdhb3 T C 18: 37,301,508 S176P probably benign Het
Pdcd1lg2 C T 19: 29,454,467 R212W probably benign Het
Plin3 T C 17: 56,286,576 Y46C probably damaging Het
Rfx7 G A 9: 72,619,538 E1337K possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr1 G T 7: 29,104,610 N584K probably damaging Het
Scmh1 T C 4: 120,522,620 V544A probably benign Het
Sdk2 G A 11: 113,943,254 T34M probably damaging Het
Serpinb9e T A 13: 33,259,807 L270H probably damaging Het
Shoc2 T A 19: 54,003,049 N248K probably damaging Het
Slc25a4 T C 8: 46,209,336 Y95C probably damaging Het
Slc4a1ap A G 5: 31,534,069 N403S possibly damaging Het
Spink10 T A 18: 62,657,885 W7R probably null Het
Ssrp1 A G 2: 85,042,296 K426R possibly damaging Het
Tbc1d24 G A 17: 24,209,069 probably benign Het
Tead3 A T 17: 28,334,378 probably null Het
Timd4 A G 11: 46,843,203 *344W probably null Het
Tmem245 G A 4: 56,916,733 T65I probably damaging Het
Vmn1r12 G C 6: 57,159,655 V202L probably damaging Het
Vmn1r80 A G 7: 12,193,496 T178A probably benign Het
Vps33b T A 7: 80,283,414 probably null Het
Zmym6 T A 4: 127,108,473 probably null Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGCTGAGCTGTGTGC -3'
(R):5'- TCAGGACGCGATGCTTTCTC -3'

Sequencing Primer
(F):5'- AGCTGAGCTGTGTGCAAAGTG -3'
(R):5'- TACAGACGAGCACCCTGG -3'
Posted On2017-06-26