Incidental Mutation 'Z31818:Vmn2r74'
ID482040
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Namevomeronasal 2, receptor 74
SynonymsEG546980
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85951867-85961482 bp(-) (GRCm38)
Type of Mutationintron (30 bp from exon)
DNA Base Change (assembly) T to C at 85955521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
Predicted Effect probably null
Transcript: ENSMUST00000166355
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85957130 missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85957580 missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85957484 missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85957206 missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85961292 missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85957592 missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85961461 missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85957323 missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85952516 missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85952616 missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85957373 missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85952692 nonsense probably null
IGL03370:Vmn2r74 APN 7 85958057 missense probably benign
R0115:Vmn2r74 UTSW 7 85957356 missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85952283 missense probably benign 0.06
R0415:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R0571:Vmn2r74 UTSW 7 85952421 missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85961309 nonsense probably null
R0659:Vmn2r74 UTSW 7 85955914 splice site probably benign
R1202:Vmn2r74 UTSW 7 85961337 missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85952442 missense probably benign
R2079:Vmn2r74 UTSW 7 85957175 missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85961314 missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85956114 missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85958258 missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85958137 missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85957187 missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85957354 missense probably benign
R4294:Vmn2r74 UTSW 7 85957416 missense probably benign 0.14
R4645:Vmn2r74 UTSW 7 85957109 missense probably benign
R4646:Vmn2r74 UTSW 7 85957574 missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85961347 missense probably benign
R4901:Vmn2r74 UTSW 7 85955991 nonsense probably null
R5532:Vmn2r74 UTSW 7 85951989 missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85957380 missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85957140 missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85958290 missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85952072 missense probably damaging 1.00
R6255:Vmn2r74 UTSW 7 85952451 missense possibly damaging 0.90
R6468:Vmn2r74 UTSW 7 85961391 missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85957550 missense probably damaging 1.00
R6816:Vmn2r74 UTSW 7 85961413 nonsense probably null
R6836:Vmn2r74 UTSW 7 85957422 missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R6995:Vmn2r74 UTSW 7 85957652 critical splice acceptor site probably null
R7186:Vmn2r74 UTSW 7 85951942 nonsense probably null
R7246:Vmn2r74 UTSW 7 85955965 missense probably benign
R7374:Vmn2r74 UTSW 7 85957422 missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85957071 nonsense probably null
R7525:Vmn2r74 UTSW 7 85961302 missense probably benign
R7569:Vmn2r74 UTSW 7 85952336 missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85957538 missense probably benign 0.11
R8119:Vmn2r74 UTSW 7 85961482 start codon destroyed probably null 0.08
R8131:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R8147:Vmn2r74 UTSW 7 85956019 nonsense probably null
R8181:Vmn2r74 UTSW 7 85956116 missense probably damaging 1.00
R8184:Vmn2r74 UTSW 7 85952246 missense probably benign 0.00
Z1176:Vmn2r74 UTSW 7 85955627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGGGATTTAACATAGTGAG -3'
(R):5'- CTCTGATGTGTGAATAACTGGATG -3'

Sequencing Primer
(F):5'- AGTGAGACAAAAATACAGTTCAAGAG -3'
(R):5'- ATGTGTGAATAACTGGATGTTTGTC -3'
Posted On2017-06-27